View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19828_low_27 (Length: 376)
Name: NF19828_low_27
Description: NF19828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19828_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 6e-90; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 178 - 357
Target Start/End: Complemental strand, 24711545 - 24711366
Alignment:
| Q |
178 |
gaaagttaattaaggacaaaaatatcattacggatcatatgaaaatgagtaataaggaattggaggagtttatctgcacaatatcgtttggagatgaccc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24711545 |
gaaagttaattaaggacaaaaatatcattacggatcatatgaaaatgagtaataaggaattggaggagtttatccgcacaatatcgtttggagatgaccc |
24711446 |
T |
|
| Q |
278 |
tgggatggttggttctggttatgtcaaaatagttgattaatttaacaaatactctagtctacggtgtttcttcttaaacg |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24711445 |
tgggatggttggttctggttatgtcaaaatagttgatccatttaacaaatactctagtctacggtgtttcttcttaaacg |
24711366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 24711782 - 24711951
Alignment:
| Q |
1 |
gaacttgtgttagtgacatttaatcatgccatgttggctatcgtaacgggtaaggtccaatgatgagaagatgatggatgcagccgcataccagaaatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24711782 |
gaacttgtgttagtgacatttaatcataccatgttggctatcgtaacgggtaaggtccaatgatgagaagatgatggatgcagccgcatacaagaaatga |
24711881 |
T |
|
| Q |
101 |
agaagggatacacagggggaacacgttgcaagttgcaacacttgatgagattcccttagagtgtgtttgg |
170 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
24711882 |
agaagggatacacagggtgaacacgttgcaagttgcaacacttgatgagattcccttagggtatgtttgg |
24711951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 212 - 333
Target Start/End: Complemental strand, 24807028 - 24806907
Alignment:
| Q |
212 |
tcatatgaaaatgagtaataaggaattggaggagtttatctgcacaatatcgtttggagatgaccctgggatggttggttctggttatgtcaaaatagtt |
311 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||| ||||| | |||| ||||| ||||| ||| | ||||||||||||||| | ||||| || |
|
|
| T |
24807028 |
tcatatgaaaatgagtaataaggagttggaggagtgtatgcgcacagtgtcgtctggagttgaccatggagtagttggttctggttattttaaaatggta |
24806929 |
T |
|
| Q |
312 |
gattaatttaacaaatactcta |
333 |
Q |
| |
|
||| | || ||||| ||||||| |
|
|
| T |
24806928 |
gatgatttgaacaactactcta |
24806907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 189 - 313
Target Start/End: Complemental strand, 24715888 - 24715773
Alignment:
| Q |
189 |
aaggacaaaaatatcattacggatcatatgaaaatgagtaataaggaattggaggagtttatctgcacaatatcgtttggagatgaccctgggatggttg |
288 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||| ||||||||||| ||||||| || | ||||| ||||| ||| || |||| |
|
|
| T |
24715888 |
aaggacaagaatatcattgtggatcatatgaaaatgagtaata---------aggagtttatccgcacaatgtcatctggagttgaccatggaatagttg |
24715798 |
T |
|
| Q |
289 |
gttctggttatgtcaaaatagttga |
313 |
Q |
| |
|
|||||| |||||||||||| ||||| |
|
|
| T |
24715797 |
gttctgattatgtcaaaatggttga |
24715773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University