View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19828_low_54 (Length: 250)
Name: NF19828_low_54
Description: NF19828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19828_low_54 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 35249937 - 35249693
Alignment:
| Q |
1 |
tgagtgagaaactaagtaggttatttgcataaacagaataaatcaagttttggtagcagaaattgatgataagttccacctttgaatgttttagcgacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35249937 |
tgagtgagaaactaagtaggttatttgcataaacagaataaatcaagttttggtaacagaaattgatgataagttccacctttgaatgttttagcgacaa |
35249838 |
T |
|
| Q |
101 |
aatacataatggattagaatcttttgctatgtgtaattctttgtagtgtatttattacaaagccttgtgactaaaagctaaaacacaaaagttgcatgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35249837 |
aatacataatggattagaatcttttgctatgtgtaattctttgtagtgtatttattacaaagccttgtgactaaaagctaaaacacaaaagttgcatgaa |
35249738 |
T |
|
| Q |
201 |
ggaaggggattttgtctattgttcctgagaattccctatgcttct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35249737 |
ggaaggggattttgtctattgttcctgagaattctctatgcttct |
35249693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 198 - 245
Target Start/End: Complemental strand, 7321514 - 7321467
Alignment:
| Q |
198 |
gaaggaaggggattttgtctattgttcctgagaattccctatgcttct |
245 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| | |||||||| |
|
|
| T |
7321514 |
gaaggaaggggattttgtctattgatcctgagaattctccatgcttct |
7321467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 7229589 - 7229649
Alignment:
| Q |
48 |
ttttggtagcagaaattgatgataagttccacctttgaatgttttagcgacaaaatacata |
108 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7229589 |
ttttggttgcagaaattgttgacgagttccacctttgaatgttttcaggacaaaatacata |
7229649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University