View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19828_low_56 (Length: 249)
Name: NF19828_low_56
Description: NF19828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19828_low_56 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 2790571 - 2790346
Alignment:
| Q |
1 |
ctttttcaatagggaaaaagttcaacttgaccatagaatcaaggtataatgcgccaaatttgcttgttgaaaatggatgatatgataaggatgtgattta |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2790571 |
ctttttcaatagggaaaaggttcaacttgaccatagaatcaaggtataatgcgccaaatttacttgttgaaaatggatgatatgataaggatgtgattta |
2790472 |
T |
|
| Q |
101 |
agtttaagaaattctaattgtactaattacaattcaatttacaatgaaaccatatgaatagtgtctagtctagaatcaactatttaaaaagttgattaaa |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2790471 |
agtttgagaaattctaattgtactaattataattcaatttacaatcaaaccatatgaatagtgtctagtctagaatcaactatttaaaaagttgattaaa |
2790372 |
T |
|
| Q |
201 |
cccatcaccatgtcttaaccattcaa |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2790371 |
cccatcaccatgtcttaaccattcaa |
2790346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University