View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19828_low_63 (Length: 235)
Name: NF19828_low_63
Description: NF19828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19828_low_63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 46 - 217
Target Start/End: Complemental strand, 53683026 - 53682856
Alignment:
| Q |
46 |
tcattaggacattaatttggtgatgtagacacgacattgacatcgatagtaattttagaaaatggaatcggtgaatgtaaccactgaacacatatcggac |
145 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
53683026 |
tcattagaacattaatttggtgatgtagacacgacattgacatcgatagtaattttagaaaatggaatcggtgaacgtaaccactga-cacatatcggac |
53682928 |
T |
|
| Q |
146 |
acggaacatgtctttaatatgaagtgacaaagtccttgtctttgccattaactctcttttcattggaaatta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682927 |
acggaacatgtctttaatatgaagtgacaaagtccttgtctttgccattaactctcttttcattggaaatta |
53682856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University