View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19829_high_27 (Length: 313)
Name: NF19829_high_27
Description: NF19829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19829_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 297
Target Start/End: Complemental strand, 1546311 - 1546030
Alignment:
| Q |
18 |
ctaacgaggggtgttgctgttattgttgatgcaagtaacagttcaaattacatgacctcttcaatttaggtgaaattcctcacttattagcataaaactt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1546311 |
ctaacgaggggtgttgctgttattgttgatgcaagtaacagttcaaattacatgacctcttcaatttaggtgaaattcctcacttattagcataaaactt |
1546212 |
T |
 |
| Q |
118 |
ggttgttgtcttcattctagttgaaattgcttttgttgttacattgttactgtttgaatgaaattgtttttc--nnnnnnnnnnttcttttttattttga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
1546211 |
ggttgttgtcttcattctagttgaaattgcttttgttgttacattgttactgtttgaatgaaattgtttttcaaaaaaaaaaatttcctttttattttga |
1546112 |
T |
 |
| Q |
216 |
ggtattgtacgacctatccatgcagaaataatatactataacatggagttattgtacgaccattatagcataataaaacctc |
297 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1546111 |
ggtattgtgcgacctatccatgcagaaataatatactataacatggagttattgtacgaccattataacataataaaacctc |
1546030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University