View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19829_high_41 (Length: 241)

Name: NF19829_high_41
Description: NF19829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19829_high_41
NF19829_high_41
[»] chr7 (1 HSPs)
chr7 (16-234)||(11681167-11681384)


Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 234
Target Start/End: Complemental strand, 11681384 - 11681167
Alignment:
16 agtttcttgtgctaaagtggtgaagagattcaaagatggacaagttcattttggtgatctttttgctggaaactacttattcatgcaagtcaatccttca 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
11681384 agtttcttgtgctaaagtggtgaagagattcaaagatggacaagttcattttggtgatctttttgctggaaactacttgttcatgcaagtcaatccttca 11681285  T
116 tcactcaactaccttggaaaagatatctctattcccaaaattgcttaatgccatgtcttgtttatttacttttggcatgcactttcttgagaaataaata 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||    
11681284 tcactcaactaccttggaaaagatatctctattcccaaaattgcttaatg-catgtcttgtttatttacttttggcatgcactttcttaagaaataaata 11681186  T
216 ttttggttttcttctctct 234  Q
    ||||||||||||| |||||    
11681185 ttttggttttcttgtctct 11681167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University