View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19829_low_16 (Length: 391)
Name: NF19829_low_16
Description: NF19829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19829_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 23 - 246
Target Start/End: Original strand, 35362643 - 35362867
Alignment:
| Q |
23 |
ttactatcgtccctcacgaccaacctcttctcctgcgacattttatgaggttccgaaagagaaagaaagcgtggatggagcttccatgagagagaaagag |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35362643 |
ttactatcgtccctcacgaccaacctcttctccggtgacattttctgaggttccgaaagagaaagaaagcgtggatggagcttccatgagagagaaagag |
35362742 |
T |
|
| Q |
123 |
agccatctgttttg--gttttttaattacgaagtcattccaaaaacaattttttaaaatcaacacttgccacatcagcaagtggtacaagctctgtacaa |
220 |
Q |
| |
|
|||||| ||||||| |||||| |||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35362743 |
agccatatgttttgttttttttttattacgaagtcattcc-aaaacaattttttaaaattaacacttgccacatcagcaagtggtacaagctctgtacaa |
35362841 |
T |
|
| Q |
221 |
gttggagtggtcgatttatcatttcc |
246 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35362842 |
gttggagtggtcgatttatcatttcc |
35362867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 305 - 373
Target Start/End: Original strand, 35363692 - 35363760
Alignment:
| Q |
305 |
catttgtcatgacataactaccacaaaaccaaaatcgattaattaaatcttttgcacctaactattggg |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35363692 |
catttgtcatgacataactaccacaaaaccaaaattgattaattaaatcttttgcacctaactattggg |
35363760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University