View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19829_low_25 (Length: 323)
Name: NF19829_low_25
Description: NF19829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19829_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 17 - 265
Target Start/End: Original strand, 44715966 - 44716214
Alignment:
| Q |
17 |
agtaactagctgagcttgtacagcctaagactttgatactaatagtaatatagtattgcctattgacacactcttttcattcaatttcataaccatcgtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44715966 |
agtaactagctgagcttgtacagcctaagactttgatactaatagtaatatagtattgcctattgacacactcttttcattcaatttcataaccatcgtt |
44716065 |
T |
 |
| Q |
117 |
tggaattcatctcactaaaacatgtgcatacgtacatgcactctaatgctgcaatcccatcttgatttcttaatgtttgaattctcatggtcaatggttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44716066 |
tggaattcatctcactaaaacatgtgcatacgtacatgcactctaatgctgccatcccatcttgatttcttaatgtttgaattctcatggtcaatggttt |
44716165 |
T |
 |
| Q |
217 |
ttcatgtgataatttatgtttttctctatttagtagcctatctatgagc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44716166 |
ttcatgtgataatttatgtttttctctatttagtagcctatctatgagc |
44716214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 284 - 313
Target Start/End: Original strand, 44716230 - 44716259
Alignment:
| Q |
284 |
taccatttctattttttgcccatgcctatg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44716230 |
taccatttctattttttgcccatgcctatg |
44716259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University