View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19829_low_37 (Length: 260)
Name: NF19829_low_37
Description: NF19829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19829_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 246
Target Start/End: Original strand, 52740433 - 52740666
Alignment:
| Q |
13 |
atactcttgaatgaatggtatacctcaatagttagcaataaagcatacagcttacatgcctttattatagggtatacatatgtaaatcattaatcataga |
112 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52740433 |
atactcttgagtgaatggtatacctcaatagttagcaatatagcatatagcttacatgcctttacaatagggtatacatatgtaaatcattaatcataga |
52740532 |
T |
 |
| Q |
113 |
atgagacctgctatctctcattttcagacttgattggtcatctctgtgtgggtcagtcaacgcttgaatgaaaacattactttaccaatggaatggtttg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52740533 |
atgagacctgctatctctcattttcagacttgattggtcatctctgtgtgggtcagtcaacgcttgaatgaaaacattactttaccaaaggaatggtttg |
52740632 |
T |
 |
| Q |
213 |
tactttgtatcccatcaacagtggtatacatact |
246 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
52740633 |
tactttgtatcccatcaacaatggtatacatact |
52740666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University