View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19829_low_43 (Length: 241)
Name: NF19829_low_43
Description: NF19829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19829_low_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 234
Target Start/End: Complemental strand, 11681384 - 11681167
Alignment:
| Q |
16 |
agtttcttgtgctaaagtggtgaagagattcaaagatggacaagttcattttggtgatctttttgctggaaactacttattcatgcaagtcaatccttca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11681384 |
agtttcttgtgctaaagtggtgaagagattcaaagatggacaagttcattttggtgatctttttgctggaaactacttgttcatgcaagtcaatccttca |
11681285 |
T |
|
| Q |
116 |
tcactcaactaccttggaaaagatatctctattcccaaaattgcttaatgccatgtcttgtttatttacttttggcatgcactttcttgagaaataaata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11681284 |
tcactcaactaccttggaaaagatatctctattcccaaaattgcttaatg-catgtcttgtttatttacttttggcatgcactttcttaagaaataaata |
11681186 |
T |
|
| Q |
216 |
ttttggttttcttctctct |
234 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
11681185 |
ttttggttttcttgtctct |
11681167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University