View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19829_low_45 (Length: 238)
Name: NF19829_low_45
Description: NF19829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19829_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 223
Target Start/End: Complemental strand, 32896295 - 32896089
Alignment:
| Q |
17 |
aattttatcatatgcacaattggatgtacattgtacatctctgctaccttaccagctaaagatacttgctatattctgcattcttctacgtctccgtctc |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32896295 |
aattttatcatatgcacacttggatgtacattgtacatctctgctaccttaccagctaaggatgcttgctatattctgcattcttctacgtctccgtctc |
32896196 |
T |
|
| Q |
117 |
cgctattgtactgccttttaactttggtcttgatatcaacctctttgtcaccttctttaccccacagtaacaaatatagacccatgatgacaataaaacc |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32896195 |
cactattgtactgccttttaactttggtcttgatatcaacatctttgtcaccttctttaccccacagcaacaaatatagacccatgatgacaataaaacc |
32896096 |
T |
|
| Q |
217 |
acctatg |
223 |
Q |
| |
|
||||||| |
|
|
| T |
32896095 |
acctatg |
32896089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 140 - 223
Target Start/End: Complemental strand, 32919604 - 32919521
Alignment:
| Q |
140 |
ttggtcttgatatcaacctctttgtcaccttctttaccccacagtaacaaatatagacccatgatgacaataaaaccacctatg |
223 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32919604 |
ttggtcttgaaatcaacatctttgtcaccttctttaccccacagcaacaaatatagacccacgatgacaataaaaccacctatg |
32919521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 83 - 223
Target Start/End: Complemental strand, 32885509 - 32885369
Alignment:
| Q |
83 |
tgctatattctgcattcttctacgtctccgtctccgctattgtactgccttttaactttggtcttgatatcaacctctttgtcaccttctttaccccaca |
182 |
Q |
| |
|
|||||||||| |||||||||| | |||| ||||| | ||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
32885509 |
tgctatattcaacattcttctaagcctccttctccatttttgtactgcaatttaactttggtcttgaaatcaacctctttgtcaccttctttcccccaca |
32885410 |
T |
|
| Q |
183 |
gtaacaaatatagacccatgatgacaataaaaccacctatg |
223 |
Q |
| |
|
| |||| ||| | ||||||||| |||||||| |||||||| |
|
|
| T |
32885409 |
gcaacagatacaaacccatgatcacaataaatgcacctatg |
32885369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 133 - 212
Target Start/End: Original strand, 19503529 - 19503608
Alignment:
| Q |
133 |
tttaactttggtcttgatatcaacctctttgtcaccttctttaccccacagtaacaaatatagacccatgatgacaataa |
212 |
Q |
| |
|
|||| |||||||||||| |||||||||| ||||||||||||| |||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
19503529 |
tttacctttggtcttgaaatcaacctctctgtcaccttctttcccccacagtaacaagtatagtcccatgatgacaataa |
19503608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 140 - 223
Target Start/End: Complemental strand, 32935838 - 32935755
Alignment:
| Q |
140 |
ttggtcttgatatcaacctctttgtcaccttctttaccccacagtaacaaatatagacccatgatgacaataaaaccacctatg |
223 |
Q |
| |
|
|||||||| | ||||| |||||||||||||||||| |||||||| |||||||| | |||||||||||||||||| |||||||| |
|
|
| T |
32935838 |
ttggtcttcaaatcaatctctttgtcaccttctttcccccacagcaacaaatacaaacccatgatgacaataaatgcacctatg |
32935755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 138 - 222
Target Start/End: Complemental strand, 32953234 - 32953150
Alignment:
| Q |
138 |
ctttggtcttgatatcaacctctttgtcaccttctttaccccacagtaacaaatatagacccatgatgacaataaaaccacctat |
222 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||||||| |||||||| |||||||| | |||||||||||| ||||| ||||||| |
|
|
| T |
32953234 |
ctttggtcttgaaatcgaccactttgtcaccttctttcccccacagcaacaaatacaaacccatgatgacgataaatgcacctat |
32953150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University