View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19829_low_46 (Length: 238)
Name: NF19829_low_46
Description: NF19829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19829_low_46 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 52763981 - 52763765
Alignment:
| Q |
18 |
gcaagttggtttgctgatattgccacaaccactagaatcacataaaattttctgttgattgtccaaattgaacaaagtgatcagaaacactaaatagatt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||||| ||||||| |
|
|
| T |
52763981 |
gcaagttggtttgctgatattgccacaaccactagaatcacataaaattttatgttgattgtccaaattgaacaaagtggtctgaaacacaaaataga-- |
52763884 |
T |
|
| Q |
118 |
atgtgatgata-taccaagccaatgaaaatatgatttgccaatattgccacaaccactaacacaaagttttgaattctggtaaatgatgcctcgtatgaa |
216 |
Q |
| |
|
|| | | || ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52763883 |
--gtcaaaacggtaacaa-ctaatgaaaatatgatttgccaatattgccacaaccactaacacaaagttttgaattctggtaaatgatgcctcgtatgaa |
52763787 |
T |
|
| Q |
217 |
aagattatccttggttaggaat |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
52763786 |
aagattatccttggttaggaat |
52763765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University