View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19829_low_52 (Length: 217)
Name: NF19829_low_52
Description: NF19829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19829_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 58 - 212
Target Start/End: Complemental strand, 52763514 - 52763360
Alignment:
| Q |
58 |
taaagaaaacatctccgccgccaaaatccaacgattttcagccaactcaaacaactgcttaaacctatctctaagaggaatactaactaataaaggattt |
157 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52763514 |
taaataaaacatctccgccgctaaaatccaacgattttcagccaattcaaacaactgcttaaacctatctctaagaggaatactacctaataaaggattt |
52763415 |
T |
 |
| Q |
158 |
gttcatacaaatgttttgagtccattaccaactacccttttttaattttcttcga |
212 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52763414 |
gttcatacagatgatttgagtccattaccaactacccttttttaattttcttcga |
52763360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University