View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19829_low_53 (Length: 209)
Name: NF19829_low_53
Description: NF19829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19829_low_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 54 - 184
Target Start/End: Original strand, 9924464 - 9924595
Alignment:
| Q |
54 |
aagcatgttttgatctaaaaatattaatggaaaaaatgatg-tttagaggcaaaggagtacaactggcacatcaaagagggtgttttccaacccttttcc |
152 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9924464 |
aagcatgttttgatctaaaaatattcatggaaaaattgatggtttagaggcaaaggagtacaactggcacatcaaagagggtgttttccaacccttttcc |
9924563 |
T |
|
| Q |
153 |
aattgttctagtgtctgttcttaattctttta |
184 |
Q |
| |
|
|||| |||||||| |||||| |||||||||| |
|
|
| T |
9924564 |
aattattctagtgcatgttctcaattctttta |
9924595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University