View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1982_high_9 (Length: 224)
Name: NF1982_high_9
Description: NF1982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1982_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 21 - 210
Target Start/End: Complemental strand, 46552552 - 46552361
Alignment:
| Q |
21 |
tctcagactcaaacacccgtaatctaaaatttaccttttcaatcaccgggtaagcatatatcaaattcaaaaataacacattgaagttaattttcctaaa |
120 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46552552 |
tctcaaactcaaacatccgtaatctaaaatttactttttcaatcaccgggtaagcatttatcaaattcaaaaataacacattgaagttgattttcctaag |
46552453 |
T |
|
| Q |
121 |
cacatggtgagatgttgaagcagtcgaaaagcttctcc--atccatggtagctacttgatgtggtccagatcattcttttactggatacaat |
210 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| |||||||| |||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
46552452 |
cacatggtgagagcttgaaacagtcgaaaagcttctccatatccatggcagctacttgatgtggtccagctcatttttttactggatacaat |
46552361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University