View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1982_low_11 (Length: 227)
Name: NF1982_low_11
Description: NF1982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1982_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 30414619 - 30414816
Alignment:
| Q |
1 |
ttgtaaggaggaatgactcaattcttatataatagtttgtttgatgtatttgaatctgagataggtggggacgcctatttggttcagtatttggttcagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
30414619 |
ttgtaaggaggaatgactcaattcttatataatagtttgtttgatgtatttgaatccgagataggtggggacgcctatt------------tggttcagg |
30414706 |
T |
|
| Q |
101 |
ggaggtccatgtgaatagaaatgaccttgtagtagaattttccgctttgacaggaacgaggtggttcatggtatgtagtagaaggttgctatccatgttt |
200 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30414707 |
ggaggtccatgtgaataggaacgaccttgtagtagaattttccgctttgacaggaacgaggtggttcatggtatgtagtagaaggttgctatccatgttt |
30414806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University