View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1982_low_13 (Length: 224)
Name: NF1982_low_13
Description: NF1982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1982_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 2e-63; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 6350776 - 6350654
Alignment:
| Q |
1 |
atgtgaaggaattccattccctcacttcctacttacgatcatgttattatgtatgtttgttttattgttaatgttttactttacatcaataagaattatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6350776 |
atgtgaaggaattccattccctcacttcctacttacgatcatgttattatgtatgtttgttttattgttaatgttttactttacatcaataagaattatt |
6350677 |
T |
 |
| Q |
101 |
gtgtctgtttgtaccttgtaaca |
123 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6350676 |
gtgtctgtttgtaccttgtaaca |
6350654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 207
Target Start/End: Complemental strand, 6350603 - 6350518
Alignment:
| Q |
122 |
caattgtctcatatggttcaaatatggtatcaattgagtttttcctcaattctctctgatttctcgcacgacttttttctccttct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6350603 |
caattgtctcatatggttcaaatatggtatcaactgagtttttcctcaattctctctgatttctcgcacaacttttttctccttct |
6350518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 52 - 117
Target Start/End: Complemental strand, 6287205 - 6287140
Alignment:
| Q |
52 |
tatgtttgttttattgttaatgttttactttacatcaataagaattattgtgtctgtttgtacctt |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | ||||||||||| |||||||||| |||||||||| |
|
|
| T |
6287205 |
tatggttgttttattgttaatgttttacttaaaatcaataagaactattgtgtctttttgtacctt |
6287140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University