View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1982_low_9 (Length: 242)
Name: NF1982_low_9
Description: NF1982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1982_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 7585693 - 7585799
Alignment:
| Q |
1 |
ccagtttcaccacttacaacattttccactcccaacaaagattcaaacggtgcgttttgctttttctttgtttcacaaatcacaacacttgtaactgaca |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
7585693 |
ccagtttcatcacttacaacattttccactcccaacaaagattcaaacggtgcgttttgctttttctctgtttcacaaatcacaacacttgtaattgaca |
7585792 |
T |
|
| Q |
101 |
tcacttc |
107 |
Q |
| |
|
||||||| |
|
|
| T |
7585793 |
tcacttc |
7585799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 142 - 234
Target Start/End: Original strand, 7585832 - 7585924
Alignment:
| Q |
142 |
agatctttcgacgaagacatgtgtaccttgtaatgcaaaggatttgcaacctatgacccaagatgcagccaatgctttgattgcacaggttct |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7585832 |
agatctttcgacgaagacatgtgtaccttgtaatgcaaaggatttgcaacctatgacccaagatgcagccaatgctttgattgcacaggttct |
7585924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University