View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19833_low_14 (Length: 208)
Name: NF19833_low_14
Description: NF19833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19833_low_14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 11758517 - 11758724
Alignment:
| Q |
1 |
cacaaggatccgttggtgaaactccttctcatacttattcgttgcttcttcgataccgcgacgaattcgcgaagctaggttctccggttaaagctacttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11758517 |
cacaaggatccgttggtgaaactccttctcatacttattcgttgcttcttcgataccgcgacgaattcgcaaagctaggttctccggttaaagctacttc |
11758616 |
T |
|
| Q |
101 |
aattgttgtagaagatttttctcttcataacaatgtacgttttgtttcatcaatttcttagttcaaaatgttaataatatgctaattattctagtttaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11758617 |
aattgttgtagaagatttttctcttcataacaatgtacgttttgtttcatcaatttcttagttcaaaatgttaataatatgctaattattctagtttaac |
11758716 |
T |
|
| Q |
201 |
ttttattt |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
11758717 |
ttttattt |
11758724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University