View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19834_low_11 (Length: 214)
Name: NF19834_low_11
Description: NF19834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19834_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 56 - 200
Target Start/End: Original strand, 39365275 - 39365419
Alignment:
| Q |
56 |
tgactttgagattctgttgtgtgaggaagctgccataactcagccctaagtccagtttttcgaaccctttttagaaccttcttctgatcagcaaaaccat |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365275 |
tgactttgagattctgttgtgtgaggaagctgccataactcagccctaagtccagtttttcgaaccctttttagaaccttcttctgatcagcaaaaccat |
39365374 |
T |
|
| Q |
156 |
tcaccgtcaccttttgcaacttcatgtctatttcaatgtcatcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39365375 |
tcaccgtcaccttttgcaacttcatgtctatttcaatgtcatcca |
39365419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University