View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19835_high_1_N (Length: 355)
Name: NF19835_high_1_N
Description: NF19835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19835_high_1_N |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 170 - 326
Target Start/End: Complemental strand, 43184417 - 43184261
Alignment:
| Q |
170 |
gtgtcaatggtcagtttttatgtcccccagttctttgtatgttttcatctttggatttcgtaacataaaccatgatgagtgtgatcatctacaattgtta |
269 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43184417 |
gtgtcaatggtcaggttttatgtcccccagttctttgtatgctttcatctttggatttcgtaacataaaccatgatgagtgtgatcatctacagttgtta |
43184318 |
T |
|
| Q |
270 |
gaaaatagaaatagatgtgaatagaggtgataacaagtcgactcctggtgtctatat |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43184317 |
gaaaatagaaatagatgtgaatagaggtgataacaagtcgactcctggtgtctatat |
43184261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 25 - 124
Target Start/End: Complemental strand, 43184560 - 43184461
Alignment:
| Q |
25 |
catcaccataaccatattgaagatactcacggttcttactgtgtatttgcctaatcataagtgttttaattaagctattaattattgcaatttaggttgg |
124 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43184560 |
catcaccataaccatattgaaaatactcacggttcttactgtgtatttgcctaatcataagtattttaatcaagctattaattattgcaatttaggttgg |
43184461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University