View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19836_high_65 (Length: 228)
Name: NF19836_high_65
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19836_high_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 10 - 210
Target Start/End: Complemental strand, 32191959 - 32191759
Alignment:
| Q |
10 |
tagattattctcttagtggagatttgtaaatctatgggatgaattggctatataaccaattcagctatgatgtaataatcaggcagaattataatgaaaa |
109 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32191959 |
tagattcttctcttagtggagattcgtaaatctatgggatgaattggctatataaccaattcagctatgatgtaataatcaggcagaattataatgaaaa |
32191860 |
T |
 |
| Q |
110 |
atcacttatctaataaacactttaatttggtaatcaaataaaataaaaacccagaaattggtagtggagctccctcctgctttcatagttattgtctatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32191859 |
atcacttatctaataaacactttaatttggtaatcaaataaaataaaaacccagaaattggtagtggagctccctcctgctttcgtagttattgtctatg |
32191760 |
T |
 |
| Q |
210 |
a |
210 |
Q |
| |
|
| |
|
|
| T |
32191759 |
a |
32191759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University