View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19836_high_65 (Length: 228)

Name: NF19836_high_65
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19836_high_65
NF19836_high_65
[»] chr4 (1 HSPs)
chr4 (10-210)||(32191759-32191959)


Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 10 - 210
Target Start/End: Complemental strand, 32191959 - 32191759
Alignment:
10 tagattattctcttagtggagatttgtaaatctatgggatgaattggctatataaccaattcagctatgatgtaataatcaggcagaattataatgaaaa 109  Q
    |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32191959 tagattcttctcttagtggagattcgtaaatctatgggatgaattggctatataaccaattcagctatgatgtaataatcaggcagaattataatgaaaa 32191860  T
110 atcacttatctaataaacactttaatttggtaatcaaataaaataaaaacccagaaattggtagtggagctccctcctgctttcatagttattgtctatg 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
32191859 atcacttatctaataaacactttaatttggtaatcaaataaaataaaaacccagaaattggtagtggagctccctcctgctttcgtagttattgtctatg 32191760  T
210 a 210  Q
    |    
32191759 a 32191759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University