View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19836_low_24 (Length: 379)

Name: NF19836_low_24
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19836_low_24
NF19836_low_24
[»] chr3 (2 HSPs)
chr3 (289-377)||(46016567-46016655)
chr3 (292-341)||(9738866-9738915)


Alignment Details
Target: chr3 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 289 - 377
Target Start/End: Original strand, 46016567 - 46016655
Alignment:
289 atcatgcactttaccttcccctcttccagtttcctccttctactttgttcatggtggaaagatccaatgttgttaagctcttcttcttc 377  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||    
46016567 atcatgcactttaccttcccctcttccaatttcctccttctactttgttcatggtggaaagacccgatgttgttaagctcttcttcttc 46016655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 292 - 341
Target Start/End: Original strand, 9738866 - 9738915
Alignment:
292 atgcactttaccttcccctcttccagtttcctccttctactttgttcatg 341  Q
    ||||||||||||| ||||||| |||||||||||| | |||||||||||||    
9738866 atgcactttacctccccctctgccagtttcctccatttactttgttcatg 9738915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University