View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19836_low_25 (Length: 376)
Name: NF19836_low_25
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19836_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 28 - 325
Target Start/End: Original strand, 8097608 - 8097905
Alignment:
| Q |
28 |
aaaatgttgtgagccttccaaatcatctaaacgagagctaaccaaatgagttgaaaacacccccttggttttaaagcacgaacctatagatcacataatt |
127 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |||||||||| |
|
|
| T |
8097608 |
aaaatgttgcgagcctttcaaatcatctaaacgatagctaaccaaatgagttgaaaacacccccttgatttcaaagcacgaacctatagctcacataatt |
8097707 |
T |
 |
| Q |
128 |
gttgaacatgggcagtagcttcgttagataatgcacaagagatacccaactaatgcaagaaggagaaccaaacttttgaaaaaatgccacatttgaaaat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8097708 |
gttgaacatgggcagtagcttcgttagataatgcacaagagatacccaactaatgcaagatggagaaccaaacttttgaaaaaatgccacatttgaaaat |
8097807 |
T |
 |
| Q |
228 |
atnnnnnnntgcgataaattttcttcaagatcacatccattaacgcataaacacaaaccatgagaaataatgccaagttatcttttgttggaagacaa |
325 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8097808 |
ataaaaaaatgcgataaattttcttcaagatcacatccattaatgcataaacacaaaccatgagaaataatgccaagttatcttttgttggaagacaa |
8097905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University