View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19836_low_33 (Length: 343)
Name: NF19836_low_33
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19836_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 10 - 231
Target Start/End: Original strand, 24698366 - 24698587
Alignment:
| Q |
10 |
aagaatatgctacgtgattgatgatgactataaaattcaagagaacctagtgaagctgcaaatgaatgacaccactccttgaactgatcatccattgtat |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24698366 |
aagaaaatgctacgtgattgatgatgactataaaattcaagagaacctagcgaagctgcaaatgaatgacaccactccttgaactgatcatccattgtat |
24698465 |
T |
 |
| Q |
110 |
gtttttatttttgccttgaaagattgattcactagcttgggtgaattatgctagagcagacaaggtatatattcattctatgaacaaacaggtttcagta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24698466 |
gtttttatttttgccttgaaagattgattcactagcttgggtgaattatgctagagcagacaaggtatatattcattctatgaacaaacaggtttcagta |
24698565 |
T |
 |
| Q |
210 |
aagtggaggactcaatttccat |
231 |
Q |
| |
|
||||||||||||||| |||||| |
|
|
| T |
24698566 |
aagtggaggactcaagttccat |
24698587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University