View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19836_low_35 (Length: 323)
Name: NF19836_low_35
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19836_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 304
Target Start/End: Complemental strand, 4568750 - 4568447
Alignment:
| Q |
1 |
actagtaaagccatcactacctgctggatattggggaaatggttgtgttccaatgtatgttcaattgagtgctaaagatttgatagaacaacccatttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4568750 |
actagtaaagccatcactacctgctggatattggggaaatggttgtgttccaatgtatgttcaattgagtgctaaagatttgatagaacaacccatttgg |
4568651 |
T |
 |
| Q |
101 |
gaaacagcagaactaataagaaagagtaaaaccaatgtcactgatgagtatattcgctctttcattgattatcaacatttgcattatgctgatgggatca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4568650 |
gaaacagcagaactaataagaaagagtaaaaccaatgtcactgatgagtatgttcgctctttcattgattatcaacatttgcattatgctgatgggatca |
4568551 |
T |
 |
| Q |
201 |
cagcaggaaaatgggtgagtggtttcactgattggagacacttaggccattcaactgtggattttggttggggaggtcctgttactgttttgccacttgg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4568550 |
cagcaggaaaatgggtgagtggtttcactgattggagacacttgggccattcaactgtggattttggttggggaggtcctgttactgttttgccacttgg |
4568451 |
T |
 |
| Q |
301 |
taga |
304 |
Q |
| |
|
|||| |
|
|
| T |
4568450 |
taga |
4568447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University