View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19836_low_38 (Length: 312)
Name: NF19836_low_38
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19836_low_38 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 34824633 - 34824804
Alignment:
| Q |
1 |
ttataggattactaatttatattggagaatggtaaacacttatgtttataatattctaataaaataattggacacgctcttaaaaaatatattggacctc |
100 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34824633 |
ttataggaatactaatttatattagagaatggtaaacacttatgttgataatattctaataaaataattggacatgctcttaaaaaatatattggacctc |
34824732 |
T |
 |
| Q |
101 |
agtttagtcaatgagttaactcgtatgagatcagacaaaatcaattgagggaagaattaaacggatattatt |
172 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34824733 |
agtttagtcaatgagttaacttgtatgagatcagacaaaatcaattgagggaagaattaaacggatattatt |
34824804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 218 - 293
Target Start/End: Original strand, 34824805 - 34824880
Alignment:
| Q |
218 |
atcttgaggtacatataaactttatattctaannnnnnnnatcttctcaaataaaataaaaatttttggaaattcc |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||||| |
|
|
| T |
34824805 |
atcttgaggtacatataaactttatattctaattttatttatcttctcaaataaaatttaattttttggaaattcc |
34824880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University