View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19836_low_41 (Length: 303)
Name: NF19836_low_41
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19836_low_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 60 - 294
Target Start/End: Original strand, 37571276 - 37571508
Alignment:
| Q |
60 |
ggactaatccgttaacactaaacttataggattgattatgcatttggccaagatattattattgttgctcatgagttaattcattctat---tagtcgca |
156 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37571276 |
ggactaatccgttaacattaaacttataggattgattatgcatttggccaagatattattattgttgctcatgagttaattcattctattagtagtcgca |
37571375 |
T |
|
| Q |
157 |
tgaaaggtnnnnnnnnnnnnngggattttgtgtatc-aaaattgttattcatagcatagggcctatgataggatttcttggaaatttatcagctactgtt |
255 |
Q |
| |
|
|||||||| ||||||||||||||| |||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37571376 |
tgaaaggt-aaaaaagaaaaagggattttgtgtatcaaaaattattatt-----catagggcatatgataggatttcttggaaatttatcagctactgtt |
37571469 |
T |
|
| Q |
256 |
tagatgagcttatttgggtaatgggcaggacaccatatt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37571470 |
tagatgagcttatttgggtaatgggcaggacaccatatt |
37571508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University