View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19836_low_47 (Length: 283)
Name: NF19836_low_47
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19836_low_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 49 - 259
Target Start/End: Complemental strand, 3916435 - 3916224
Alignment:
| Q |
49 |
agagttgctaactaacaacaggttagaaccaaattacacatgtactgtttattttctaatatatacttttgcctttgcagcacaccagtgctattgttt- |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3916435 |
agagttgctaactaacaacaggttagaaccaaattacacatgtactgattattttctaatatatacttttgcctttgcagcacaccagtgctattgtttt |
3916336 |
T |
|
| Q |
148 |
attaacaaaggcgcctcctcattacaatttctctagtatgttaattttatggctttcaataatgtggcccttttctaacataatgaacacataacttata |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3916335 |
attaacaaaggcgcctcctcattacaatttctctagtatgttaattttatggctttcaataatgtggcccttttctaacataatgaacacataacttata |
3916236 |
T |
|
| Q |
248 |
tacatgacatgc |
259 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3916235 |
tacatgacatgc |
3916224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 3916518 - 3916469
Alignment:
| Q |
1 |
ttctttctctttaccaaattgaagaccaaaaaaccagatacagaaccaag |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3916518 |
ttctttctctttaccaaattgaagaccaaaaaaccagatacagaaccaag |
3916469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University