View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19836_low_48 (Length: 279)
Name: NF19836_low_48
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19836_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 11373202 - 11372939
Alignment:
| Q |
1 |
tgacaaactagatgtggaacccaatgcaatgatttgggctaatttattgggtgcttgcagtatacatggagatgaaaaaaggggactgagagcggctgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11373202 |
tgacaaactagatgtggaacccaatgcaatgatttgggctaatttattgggtgcttgcagtatacatggagatgaaaaaaggggactgagagcggctgag |
11373103 |
T |
 |
| Q |
101 |
aaacttatcgagttagaaccgcaaaattcttctccatatgtattactttataatatgcatgctggatcaggacattgggatgaagctaaatctctaagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11373102 |
aaacttatcgagttagaaccgcaaaattcttctccatatgtactactttataatatgcatgctggatcaggacattgggatgaagctaaatctctaagga |
11373003 |
T |
 |
| Q |
201 |
gaacaatggtacagaatgaagttcaaaaaacgcccgggtgtagctggattgtagttgacaaaac |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11373002 |
gaacaatggtacagaatgaagttcaaaaaacgcccgggtgtagctggattgtagttgacaaaac |
11372939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University