View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19836_low_49 (Length: 276)
Name: NF19836_low_49
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19836_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 10 - 261
Target Start/End: Original strand, 30255170 - 30255421
Alignment:
| Q |
10 |
gcataggattgttaacaaaatcatgattatcttttatatcacatatcttttgcataagacaaatgagagtgattttaatttccatcaagatttaacccaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30255170 |
gcataggattgttaacaaaatcatgattatcttttatatcacatatcttttgcataagacaaatgagagtgattttaatttccatcaagatttaacccaa |
30255269 |
T |
 |
| Q |
110 |
tacaacattagcaaataatgtatagacatatatatacatcagctttctccttcacagagaatccaatcgatgtaaaatgacatttttgttgtatagcaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30255270 |
tacaacattagcaaataatgtatagacatatatatacatcagctttctccttcacagagaatccaatcgatgtaaaatgacatttttgttgtatagtaaa |
30255369 |
T |
 |
| Q |
210 |
atgtctacactcagtggccctaaccagtaaccatgtttcaaaacataggggt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30255370 |
atgtctacactcagtggccctaaccagtaaccatgtttcaaaacataggggt |
30255421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University