View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19836_low_50 (Length: 268)
Name: NF19836_low_50
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19836_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 28054005 - 28054262
Alignment:
| Q |
1 |
caaccaatcacaaaacgctgcaatttgcttctgttcatttcgaaactttttaccaagttccgaaaccgcagagttttttgcgagattgtctttggtagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28054005 |
caaccaatcacaaaacgctgcaatttgcttctgttcatttcgaaactttttaccaagttccgaaaccgcagagttttttgcgagattgactttggtagga |
28054104 |
T |
|
| Q |
101 |
gtgtttgaacttttcggcaggtcgttttcaatgcaaaaagtcgtatccgtagatttgactggagattttttgttctcgtgatctaatgtactactctttg |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28054105 |
gtgtttgaacttttcggcacgtcgttttcagtgcaaaaagtcgtatccgtagatttgactggagattttttcttctcgtgatctaatgtactactctttg |
28054204 |
T |
|
| Q |
201 |
aagattcatcgaaccttttctctggaaattgcctaggaaaaaagtaagttgctctgtg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28054205 |
aagattcatcgaaccttttctctggaaattgcctaggaaaaaagtaagttgctctgtg |
28054262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University