View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19836_low_52 (Length: 264)
Name: NF19836_low_52
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19836_low_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 3 - 246
Target Start/End: Complemental strand, 7433450 - 7433207
Alignment:
| Q |
3 |
gaattggaaggagattcataatttcatagcaagtaatcttctaatttatgcgcatacccttttcttgaatatacaagcaaggttgacgatttcagttcgt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7433450 |
gaattggaaggagattcataatttcatagcaagtaatcttctaatttatgcgcatacccttttcttgaatatacaagcaaggttgacaatttcagttcgt |
7433351 |
T |
 |
| Q |
103 |
cttatttgctttgtcatgctgtcctgctgcttattttcatttcctttctgagataatctgactgcgacgtcaactgtccaattaaacatatctctagcta |
202 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7433350 |
cttatttgcttcgtcatgctgtcctgctgcttattttcatttcctttctgagataatctgactgcgacgtcaactgtccaattaaacatatccctagcta |
7433251 |
T |
 |
| Q |
203 |
gtgtctgttagaccgcgcaaaacagtggcagaatatgagggact |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7433250 |
gtgtctgttagaccgcgcaaaacagtggcagaatatgagggact |
7433207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 57 - 155
Target Start/End: Original strand, 11655187 - 11655285
Alignment:
| Q |
57 |
tacccttttcttgaatatacaagcaaggttgacgatttcagttcgtcttatttgctttgtcatgctgtcctgctgcttattttcatttcctttctgaga |
155 |
Q |
| |
|
|||||| ||||||||| |||||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
11655187 |
taccctattcttgaattggcaagcaaggtcaacgatttcagttcgtcttatttgcttcaccatgctgtcctgctgctcgttttcatttcctttccgaga |
11655285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University