View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19836_low_54 (Length: 261)
Name: NF19836_low_54
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19836_low_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 7 - 254
Target Start/End: Original strand, 4410941 - 4411188
Alignment:
| Q |
7 |
agaggccgaggaaataaatcaacttcgttgaacacagccaagcgaaggataggaataaatcgcgacgagagtcctatgtcagaagcttatgctgattctt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4410941 |
agaggccgaggaaataaatcaacttcgtcaaacacaaccaagcgaaggataggaataaatcgcgacgagagtcctatgtcagaagcttatgctgattctt |
4411040 |
T |
|
| Q |
107 |
cattgcaaaggcatgctgttgaatcaaagcaatctcaactcttgatgcttctacagatggtacattgctaaccacttagattacattacattcatttggt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411041 |
cattgcaaaggcatgctgttgaatcaaagcaatctcaactcttgatgcttctacagatggtacattgctaaccacttagattacattacattcatttggt |
4411140 |
T |
|
| Q |
207 |
tttcgtaaaaccgtttacggtcctgattgcgttagtatatctctgctg |
254 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
4411141 |
tttcgtaaaaccgtttatggtcctgattgcgttagtatatgtctgctg |
4411188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University