View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19836_low_60 (Length: 249)
Name: NF19836_low_60
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19836_low_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 11373346 - 11373586
Alignment:
| Q |
1 |
actacaggcagtgagcactccaaggaatgtgacatcatccggtgaaacagatgataaagtcatctcatcaaagaccttcagtgccctttccgcataacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11373346 |
actacaggcagtgagcactccaaggaatgtgacatcatccggtgaaacagatgataaagtcatctcatcaaagaccttcagtgccctttccgcataacca |
11373445 |
T |
|
| Q |
101 |
tttttcgcaaacccaacaatcattgaattccaagaaatcacatcnnnnnnnataggcaattcttcgaaaacttttgcagcactttttacatctccacatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11373446 |
tttttcgcaaacccaacaatcattgaattccaagaaatcacatctttttttataggcaattcttcgaaaacttttgcagcactttttacatctccgcatt |
11373545 |
T |
|
| Q |
201 |
tagcatacatatctacaagggcactgctagttaattcatct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11373546 |
tagcatacatatctacaagggcactgctggttaattcatct |
11373586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University