View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19836_low_68 (Length: 234)
Name: NF19836_low_68
Description: NF19836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19836_low_68 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 6976172 - 6976370
Alignment:
| Q |
17 |
aatttggggccaaataataaagattggtatagaagaatgcatatcacacatacacacacgttgttttatttggtgtgatttcctttttctagcttatcta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6976172 |
aatttggggccaaataataaagattggtatagaagaatgcatatcacacatacacacacgttgttttatttggtgtgatg-cctttttctagcttatcta |
6976270 |
T |
 |
| Q |
117 |
cttaattaatatctaacttttcatcactttgtttattatgatcattttcatgccctaatcctcttttaggagttttctttttgggattaatttacttgtc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6976271 |
cttaattaatatctaacttttcatcactttgtttattatgatcattttcatgccctaatcctcttttaggagttttcttttttggattaatttacttgtc |
6976370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University