View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19837_high_7 (Length: 237)
Name: NF19837_high_7
Description: NF19837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19837_high_7 |
 |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 15)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 23221207 - 23221407
Alignment:
| Q |
1 |
tttttggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgacaacaataaaataatttaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
23221207 |
tttttggtggctggggttcgcagcccgaatcttgcatatattatgcattttctttatcaattgagttaagatcacgacgacaacaataaattaatttaaa |
23221306 |
T |
 |
| Q |
101 |
cgtgtgtcataaacatatcaataaagaatactcatcttaaaggacaacaataaataatttaaaggattagctcgacaatgtctcttttgtcttttaagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23221307 |
cgtgtgtcataaacatatcaataaagaatactcatcttaaaggacaacaataaataatttaaaggattagctcgacaatgtctcttttgtcttttaagga |
23221406 |
T |
 |
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
23221407 |
a |
23221407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 80
Target Start/End: Original strand, 13794523 - 13794574
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacgatga |
80 |
Q |
| |
|
||||||||||||||||||||| || || ||||||||| |||| ||||||||| |
|
|
| T |
13794523 |
accttgcatatattatgcattatccttatcaactgagctaagctcacgatga |
13794574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 76
Target Start/End: Original strand, 47719118 - 47719169
Alignment:
| Q |
25 |
ccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
||||||||||||||||||||||||| || || ||||||||||||| ||||| |
|
|
| T |
47719118 |
ccgaaccttgcatatattatgcattatccttaccaactgagttaagctcacg |
47719169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 82
Target Start/End: Complemental strand, 1091230 - 1091172
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
||||||||||||||| |||||||||| ||| | ||||||||||||| |||||| |||| |
|
|
| T |
1091230 |
cccgaaccttgcatacattatgcattgtctataccaactgagttaagctcacgaggaca |
1091172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 77
Target Start/End: Original strand, 31060224 - 31060270
Alignment:
| Q |
31 |
cttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| |||||||||||| |
|
|
| T |
31060224 |
cttgcatatattatgcattatctctatcaactgaattaagatcacga |
31060270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 81
Target Start/End: Complemental strand, 24978291 - 24978238
Alignment:
| Q |
28 |
aaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgac |
81 |
Q |
| |
|
|||||||||||||||||| ||| ||| | ||||||||||||| |||||||||| |
|
|
| T |
24978291 |
aaccttgcatatattatgtattatctataccaactgagttaagctcacgatgac |
24978238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 11462909 - 11462957
Alignment:
| Q |
1 |
tttttggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
|||||||||| ||||||||| | |||| ||||||||||| ||||||||| |
|
|
| T |
11462909 |
tttttggtggatggggttcgaaccccggaccttgcatattttatgcatt |
11462957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 83
Target Start/End: Original strand, 14983461 - 14983517
Alignment:
| Q |
27 |
gaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgacaa |
83 |
Q |
| |
|
|||||||| |||| |||||||||||| || ||||||||||||| ||| |||||||| |
|
|
| T |
14983461 |
gaaccttgtatattttatgcattttccttaccaactgagttaagctcaagatgacaa |
14983517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 69
Target Start/End: Original strand, 31401668 - 31401708
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaa |
69 |
Q |
| |
|
||||||||||||||||||||| | ||| ||||||||||||| |
|
|
| T |
31401668 |
accttgcatatattatgcattgtttttgtcaactgagttaa |
31401708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 34083407 - 34083363
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
|||||||||||||||| | ||| |||||| ||||||||||||||| |
|
|
| T |
34083407 |
tggtggctggggttcgaaccccaaaccttacatatattatgcatt |
34083363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 81
Target Start/End: Complemental strand, 35474014 - 35473946
Alignment:
| Q |
13 |
ggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgac |
81 |
Q |
| |
|
|||||||| | || ||||||||||||||||||||||| || || ||| |||| |||| |||||||||| |
|
|
| T |
35474014 |
ggggttcgaaccctgaaccttgcatatattatgcattatccttaccaattgagctaagctcacgatgac |
35473946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 41973325 - 41973281
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
||||||| |||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
41973325 |
tggtggccggggttcgaaccccggaccttgcatatattatgcatt |
41973281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 45190260 - 45190304
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
|||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
45190260 |
tggtggctagggtttgaatcccgaaccttgcatatattatgcatt |
45190304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 77
Target Start/End: Original strand, 49875614 - 49875662
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
||||||||||||||||||||| || || ||||||||||||| |||||| |
|
|
| T |
49875614 |
accttgcatatattatgcattgtccttaccaactgagttaagctcacga |
49875662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 77
Target Start/End: Original strand, 50849084 - 50849136
Alignment:
| Q |
25 |
ccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
||||||||| ||||||||||||||| || || ||||||||||||| |||||| |
|
|
| T |
50849084 |
ccgaaccttacatatattatgcattgtcattaccaactgagttaagctcacga |
50849136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 13)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 69
Target Start/End: Complemental strand, 45425523 - 45425459
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaa |
69 |
Q |
| |
|
||||||| ||| |||| | |||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
45425523 |
tggtggccgggattcgaaccccgaaccttgcatatattatgcattgtctttatcaactgagttaa |
45425459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 76
Target Start/End: Complemental strand, 27263411 - 27263340
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||| || | ||||||||||||| ||||| |
|
|
| T |
27263411 |
tggtggctggggttcgaactccgaaccttgcatatattatgcattgtccataccaactgagttaagttcacg |
27263340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 27 - 77
Target Start/End: Original strand, 5317301 - 5317351
Alignment:
| Q |
27 |
gaaccttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||| |||||| |
|
|
| T |
5317301 |
gaaccttgcatatattatgcattttccatatcaactgagttaagctcacga |
5317351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 15 - 77
Target Start/End: Original strand, 8879748 - 8879810
Alignment:
| Q |
15 |
ggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||| ||| | ||||||||||||| |||||| |
|
|
| T |
8879748 |
ggttcgaatcccgaaccttgcatatattatgcattgtctataccaactgagttaagctcacga |
8879810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 86
Target Start/End: Complemental strand, 34000313 - 34000251
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgacaacaa |
86 |
Q |
| |
|
|||||||||| ||||||||||||||| || || |||||||||||||| ||||| |||||||| |
|
|
| T |
34000313 |
cccgaaccttacatatattatgcattatccttatcaactgagttaagctcacggagacaacaa |
34000251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 82
Target Start/End: Original strand, 39926548 - 39926606
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
||||||| |||||||||||||||||| || || ||||||||| |||| ||||||||||| |
|
|
| T |
39926548 |
cccgaacattgcatatattatgcattgtccttatcaactgagctaagctcacgatgaca |
39926606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 70
Target Start/End: Original strand, 10362316 - 10362360
Alignment:
| Q |
26 |
cgaaccttgcatatattatgcattttctttctcaactgagttaag |
70 |
Q |
| |
|
|||||||||||||||||||||||| || || |||||||||||||| |
|
|
| T |
10362316 |
cgaaccttgcatatattatgcattctccttatcaactgagttaag |
10362360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 76
Target Start/End: Complemental strand, 38911346 - 38911298
Alignment:
| Q |
28 |
aaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
38911346 |
aaccttgcatatattatacattgtctttatcaactgagttaagctcacg |
38911298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 76
Target Start/End: Complemental strand, 27270305 - 27270234
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
||||||||| |||||| | ||||||||||||||||||||||||| || | ||||||||||||| ||||| |
|
|
| T |
27270305 |
tggtggctgaggttcgaactccgaaccttgcatatattatgcattgtccataccaactgagttaagttcacg |
27270234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 75
Target Start/End: Original strand, 37230043 - 37230089
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcac |
75 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||| |||| |
|
|
| T |
37230043 |
accttgcatatattatgcattttccttaccaactgagttaagctcac |
37230089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 9522982 - 9522938
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
||||||| |||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
9522982 |
tggtggccggggttcgaaccccaaaccttgcatatattatgcatt |
9522938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 83
Target Start/End: Complemental strand, 34807266 - 34807210
Alignment:
| Q |
28 |
aaccttgcatatattatgcatt-ttctttctcaactgagttaagatcacgatgacaa |
83 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||| ||| |||||| ||||| |
|
|
| T |
34807266 |
aaccttgcatatattatgcattgttctttatcaactgagctaaactcacgaggacaa |
34807210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 48527236 - 48527184
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacgatgac |
81 |
Q |
| |
|
||||||||||||||||||||| || || ||||||||| |||| ||||| |||| |
|
|
| T |
48527236 |
accttgcatatattatgcattgtccttatcaactgagataagctcacggtgac |
48527184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 15)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 33824955 - 33824873
Alignment:
| Q |
1 |
tttttggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgacaa |
83 |
Q |
| |
|
||||||||||| | |||| | | |||| ||||||||||||||||||||| || || ||||||||| ||||||||||| ||||| |
|
|
| T |
33824955 |
tttttggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccttatcaactgagctaagatcacgaagacaa |
33824873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 76
Target Start/End: Complemental strand, 4450313 - 4450261
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||| ||||||||| |||| ||||| |
|
|
| T |
4450313 |
cccggaccttgcatatattatgcattgtctttatcaactgagctaagctcacg |
4450261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 76
Target Start/End: Original strand, 6470626 - 6470678
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
|||||| ||| ||||||||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
6470626 |
cccgaaacttacatatattatgcattgtctttatcaactgagttaagctcacg |
6470678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 77
Target Start/End: Complemental strand, 14552399 - 14552335
Alignment:
| Q |
13 |
ggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
|||||||| | || |||||||| |||||||||||||| ||| | |||||||||||||| |||||| |
|
|
| T |
14552399 |
ggggttcgaatcctgaaccttgtatatattatgcattatctctatcaactgagttaagctcacga |
14552335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 82
Target Start/End: Original strand, 31140812 - 31140880
Alignment:
| Q |
14 |
gggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
||||||| | || |||||||||||||||||| |||| ||||| ||| |||||||||| |||||| |||| |
|
|
| T |
31140812 |
gggttcgaatcctgaaccttgcatatattatacattatctttatcagctgagttaagctcacgaggaca |
31140880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 81
Target Start/End: Original strand, 14169562 - 14169612
Alignment:
| Q |
31 |
cttgcatatattatgcattttctttctcaactgagttaagatcacgatgac |
81 |
Q |
| |
|
|||||||||||| |||||| || || |||||||||||||| |||||||||| |
|
|
| T |
14169562 |
cttgcatatattctgcattgtccttatcaactgagttaaggtcacgatgac |
14169612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 77
Target Start/End: Original strand, 331900 - 331949
Alignment:
| Q |
28 |
aaccttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
|||||||||||||||||||||| ||| | ||||||||||||| |||||| |
|
|
| T |
331900 |
aaccttgcatatattatgcattgtctctaccaactgagttaagctcacga |
331949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 70
Target Start/End: Complemental strand, 334186 - 334145
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaag |
70 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||| |||| |
|
|
| T |
334186 |
accttgcatatattatgcattgtctttatcaactgagctaag |
334145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 82
Target Start/End: Complemental strand, 788916 - 788859
Alignment:
| Q |
25 |
ccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
||||||||||||||||||||||||| || || |||||||| |||| |||||| |||| |
|
|
| T |
788916 |
ccgaaccttgcatatattatgcattgtccttaccaactgagataagctcacgaggaca |
788859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 11 - 76
Target Start/End: Original strand, 8381191 - 8381256
Alignment:
| Q |
11 |
ctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
|||||||||| | || | ||||||||||| ||||||||| ||||| ||||||||||||| ||||| |
|
|
| T |
8381191 |
ctggggttcgaaccctggaccttgcatatgttatgcattgtctttaccaactgagttaagctcacg |
8381256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 77
Target Start/End: Complemental strand, 8831258 - 8831205
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
|||| |||||||||| |||||||||| || || |||||||||||||||||||| |
|
|
| T |
8831258 |
cccggaccttgcataaattatgcattgtccttaccaactgagttaagatcacga |
8831205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 77
Target Start/End: Complemental strand, 18256934 - 18256881
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
|||| ||||||||||||||||||||| || || ||||||||| |||| |||||| |
|
|
| T |
18256934 |
cccggaccttgcatatattatgcattgtccttatcaactgagctaagctcacga |
18256881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 77
Target Start/End: Original strand, 7081669 - 7081717
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
||||||||||||||||| ||| ||||| ||||||||| |||| |||||| |
|
|
| T |
7081669 |
accttgcatatattatgtattgtctttatcaactgagctaagctcacga |
7081717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 26548321 - 26548277
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
|||||||||||||| | | ||||||||||||||||||||| |||| |
|
|
| T |
26548321 |
tggtggctggggtttgaaccccgaaccttgcatatattatacatt |
26548277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 64
Target Start/End: Original strand, 28046192 - 28046228
Alignment:
| Q |
28 |
aaccttgcatatattatgcattttctttctcaactga |
64 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
28046192 |
aaccttgcatatattatgcattgtctttatcaactga |
28046228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 29)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 82
Target Start/End: Complemental strand, 6520118 - 6520064
Alignment:
| Q |
28 |
aaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
6520118 |
aaccttgcatatattatgcattgtctttactaactgagttaagatcacgatgaca |
6520064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 86
Target Start/End: Complemental strand, 42845076 - 42845014
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgacaacaa |
86 |
Q |
| |
|
|||| ||||||||||||||||||||| || || ||||||||||||| |||||| |||||||| |
|
|
| T |
42845076 |
cccggaccttgcatatattatgcattgtcctttccaactgagttaagctcacgaggacaacaa |
42845014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 77
Target Start/End: Original strand, 39842026 - 39842075
Alignment:
| Q |
28 |
aaccttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
|||||| ||||||||||||||| || || ||||||||||||||||||||| |
|
|
| T |
39842026 |
aaccttacatatattatgcattgtccttatcaactgagttaagatcacga |
39842075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 76
Target Start/End: Original strand, 7371538 - 7371610
Alignment:
| Q |
4 |
ttggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
|||||| | |||||||| | |||| ||||||||||||||||| ||| || || |||||||||||||| ||||| |
|
|
| T |
7371538 |
ttggtgtccggggttcgaaccccggaccttgcatatattatgtattgtccttatcaactgagttaagctcacg |
7371610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 28435239 - 28435283
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
|||||||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
28435239 |
tggtggctggggtttgaaccccgaaccttgcatatattatgcatt |
28435283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 77
Target Start/End: Complemental strand, 48473007 - 48472959
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
|||||||| |||||||||||| ||||| |||||||||||||| |||||| |
|
|
| T |
48473007 |
accttgcaaatattatgcattatctttatcaactgagttaagttcacga |
48472959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 76
Target Start/End: Original strand, 19124637 - 19124684
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
||||||||||||||||| ||| ||||| |||||||||||||| ||||| |
|
|
| T |
19124637 |
accttgcatatattatgtattgtctttatcaactgagttaagctcacg |
19124684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 31 - 74
Target Start/End: Original strand, 24063225 - 24063268
Alignment:
| Q |
31 |
cttgcatatattatgcattttctttctcaactgagttaagatca |
74 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||||||||||||| |
|
|
| T |
24063225 |
cttgcatatattatgcattgtctctatcaactgagttaagatca |
24063268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 29908102 - 29908047
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacgatgacaac |
84 |
Q |
| |
|
||||||||||||||||||||| || || ||||||||||||| |||||| |||||| |
|
|
| T |
29908102 |
accttgcatatattatgcattgtccttaccaactgagttaagctcacgaagacaac |
29908047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 75
Target Start/End: Original strand, 42756116 - 42756167
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcac |
75 |
Q |
| |
|
|||||||||||||||||||||||||| || || ||||||||| |||| |||| |
|
|
| T |
42756116 |
cccgaaccttgcatatattatgcattgtccttatcaactgagctaagttcac |
42756167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 77
Target Start/End: Original strand, 16733536 - 16733582
Alignment:
| Q |
31 |
cttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||||||||| |||||| |
|
|
| T |
16733536 |
cttgcatatattatacattatctttatcaactgagttaagctcacga |
16733582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 76
Target Start/End: Complemental strand, 24488471 - 24488421
Alignment:
| Q |
26 |
cgaaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
||||||||| |||||||||||||| || || ||||||||||||||||||| |
|
|
| T |
24488471 |
cgaaccttgtatatattatgcattgtcattaccaactgagttaagatcacg |
24488421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 85
Target Start/End: Complemental strand, 7230331 - 7230270
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgacaaca |
85 |
Q |
| |
|
|||| ||||||||||||||||||||| || || |||||||| |||| |||||| ||||||| |
|
|
| T |
7230331 |
cccggaccttgcatatattatgcattgtccttaccaactgagctaagctcacgaggacaaca |
7230270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 70
Target Start/End: Original strand, 11144680 - 11144721
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaag |
70 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||| |||| |
|
|
| T |
11144680 |
accttgcatatattatgcattgtctttatcaactgaggtaag |
11144721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 70
Target Start/End: Complemental strand, 12439714 - 12439669
Alignment:
| Q |
25 |
ccgaaccttgcatatattatgcattttctttctcaactgagttaag |
70 |
Q |
| |
|
||||||||||||||||||||||||| || || ||||||||| |||| |
|
|
| T |
12439714 |
ccgaaccttgcatatattatgcattgtccttatcaactgagctaag |
12439669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 46
Target Start/End: Original strand, 23304007 - 23304048
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgc |
46 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||||||||||| |
|
|
| T |
23304007 |
tggtggccggggttcgcaccccggaccttgcatatattatgc |
23304048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 69
Target Start/End: Complemental strand, 24540894 - 24540849
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaa |
69 |
Q |
| |
|
||||| |||||||||||||||||||| ||| | ||||||||||||| |
|
|
| T |
24540894 |
cccgacccttgcatatattatgcattgtctctatcaactgagttaa |
24540849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 82
Target Start/End: Complemental strand, 36203282 - 36203229
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
||||||||||||||||||||| || || ||||||||| |||| |||||| |||| |
|
|
| T |
36203282 |
accttgcatatattatgcattgtccttatcaactgagctaagctcacgaggaca |
36203229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 82
Target Start/End: Complemental strand, 38453335 - 38453258
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
|||||||||||||||| | || | ||||||||||||||||||||| || | |||||||| |||| |||||| |||| |
|
|
| T |
38453335 |
tggtggctggggttcgaaccctggaccttgcatatattatgcattgtccatgccaactgagctaagctcacgaggaca |
38453258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 82
Target Start/End: Complemental strand, 49473715 - 49473638
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
||||| |||||||||| | |||| ||||||||||||||||||||| || || |||||| | |||| |||||| |||| |
|
|
| T |
49473715 |
tggtgactggggttcgaaccccggaccttgcatatattatgcattgtccttaccaactgggctaagctcacgaggaca |
49473638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 82
Target Start/End: Original strand, 51436617 - 51436674
Alignment:
| Q |
25 |
ccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
||||||||||||||||||||||||| | | |||||||||||||| |||||| |||| |
|
|
| T |
51436617 |
ccgaaccttgcatatattatgcattgttcgtatcaactgagttaagttcacgaggaca |
51436674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 3936697 - 3936653
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
||||||| |||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
3936697 |
tggtggccggggttcgaaccccggaccttgcatatattatgcatt |
3936653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 69
Target Start/End: Original strand, 17423168 - 17423232
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaa |
69 |
Q |
| |
|
|||||||||| ||| | | |||| ||||||||||||||||||||| ||| | |||||||||||| |
|
|
| T |
17423168 |
tggtggctggagtttgaaccccggaccttgcatatattatgcattgtctctaccaactgagttaa |
17423232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 77
Target Start/End: Original strand, 27550749 - 27550797
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
||||||||||||||||||||| | | | |||||||||||||| |||||| |
|
|
| T |
27550749 |
accttgcatatattatgcattatttctttcaactgagttaagctcacga |
27550797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 32923190 - 32923238
Alignment:
| Q |
1 |
tttttggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
||||| |||||||||||| | | |||||||||| ||||||||||||||| |
|
|
| T |
32923190 |
ttttttgtggctggggtttgaaccccgaaccttacatatattatgcatt |
32923238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 85
Target Start/End: Original strand, 40666844 - 40666924
Alignment:
| Q |
6 |
ggtggctggggttcgcagcccgaaccttgcatatattatgcattt-tctttctcaactgagttaagatcacgatgacaaca |
85 |
Q |
| |
|
|||| |||||||||| | |||| || |||||||| ||||||||| ||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
40666844 |
ggtgtctggggttcgaactccgacccctgcatataatatgcatttgtctttgtcaactgagttaagctcacggggacaaca |
40666924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 65
Target Start/End: Original strand, 43183008 - 43183044
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgag |
65 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
43183008 |
accttgcatatattatgcattgtctttatcaactgag |
43183044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 76
Target Start/End: Original strand, 51298706 - 51298758
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
||||||||||||||||||||| ||| || || |||||||||||||| ||||| |
|
|
| T |
51298706 |
cccgaaccttgcatatattatatattgtccttatcaactgagttaagttcacg |
51298758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 70
Target Start/End: Complemental strand, 56096253 - 56096209
Alignment:
| Q |
26 |
cgaaccttgcatatattatgcattttctttctcaactgagttaag |
70 |
Q |
| |
|
|||||||| ||||||||||||||| || || |||||||||||||| |
|
|
| T |
56096253 |
cgaaccttacatatattatgcattgtccttatcaactgagttaag |
56096209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 14)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 40967385 - 40967438
Alignment:
| Q |
28 |
aaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgac |
81 |
Q |
| |
|
|||||||||||||||||||||| || || |||||||||||||| |||||||||| |
|
|
| T |
40967385 |
aaccttgcatatattatgcattgtccttatcaactgagttaagctcacgatgac |
40967438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 24 - 83
Target Start/End: Original strand, 5168589 - 5168648
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgacaa |
83 |
Q |
| |
|
|||||||||||||||||||||||||| || | |||||||||||||| ||| |||||||| |
|
|
| T |
5168589 |
cccgaaccttgcatatattatgcattatccctatcaactgagttaagctcatgatgacaa |
5168648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 26 - 76
Target Start/End: Original strand, 37320529 - 37320579
Alignment:
| Q |
26 |
cgaaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||| ||||| |
|
|
| T |
37320529 |
cgaaccttgcatatattatgcattgtctttaccaactgagttaagctcacg |
37320579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 82
Target Start/End: Complemental strand, 44694739 - 44694681
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
||||| |||||||||||||||||||| ||| | |||||||||||||| |||||| |||| |
|
|
| T |
44694739 |
cccgagccttgcatatattatgcattgtctatatcaactgagttaagttcacgaggaca |
44694681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 80
Target Start/End: Original strand, 25186233 - 25186308
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatga |
80 |
Q |
| |
|
|||||||||||||| | | |||| ||||||||||||||||||||| || | ||||||||| ||| ||||||||| |
|
|
| T |
25186233 |
tggtggctggggtttgaaccccggaccttgcatatattatgcattgtccatatcaactgagctaaactcacgatga |
25186308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 39090946 - 39090887
Alignment:
| Q |
1 |
tttttggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaa |
60 |
Q |
| |
|
||||| |||| ||||||||| | ||||||| |||||||||||||||||| ||||| |||| |
|
|
| T |
39090946 |
ttttttgtggatggggttcgaatcccgaactttgcatatattatgcattgtctttatcaa |
39090887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 82
Target Start/End: Complemental strand, 4897590 - 4897536
Alignment:
| Q |
28 |
aaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
|||||||||||||||||||||| || || ||||||||||||| |||| |||||| |
|
|
| T |
4897590 |
aaccttgcatatattatgcattgtccttaccaactgagttaagctcacaatgaca |
4897536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 82
Target Start/End: Complemental strand, 4944984 - 4944930
Alignment:
| Q |
28 |
aaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
|||||||||||||||||||||| || || ||||||||||||| |||| |||||| |
|
|
| T |
4944984 |
aaccttgcatatattatgcattgtccttaccaactgagttaagctcacaatgaca |
4944930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 75
Target Start/End: Original strand, 16204832 - 16204878
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcac |
75 |
Q |
| |
|
||||||||||||||||||||| || || |||||||||||||| |||| |
|
|
| T |
16204832 |
accttgcatatattatgcattgtccttatcaactgagttaagctcac |
16204878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 83
Target Start/End: Complemental strand, 27935126 - 27935048
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgacaa |
83 |
Q |
| |
|
|||||||||||||||| | | || |||||||||||||| |||||| || | |||||||||||| |||||||||||| |
|
|
| T |
27935126 |
tggtggctggggttcgaacctcgtaccttgcatatattctgcattgtccctaccaactgagttaaactcacgatgacaa |
27935048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 77
Target Start/End: Complemental strand, 2257041 - 2256969
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
||||||| |||||||| | ||| ||||||||||||||||||||| || | ||||||||||||| |||||| |
|
|
| T |
2257041 |
tggtggccggggttcgaaccccagaccttgcatatattatgcattgtccataccaactgagttaagctcacga |
2256969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 82
Target Start/End: Complemental strand, 5676784 - 5676732
Alignment:
| Q |
30 |
ccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
|||||||||||||||||||| || || ||||||||||||| |||||| |||| |
|
|
| T |
5676784 |
ccttgcatatattatgcattgtcattaccaactgagttaagctcacgaggaca |
5676732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 81
Target Start/End: Complemental strand, 21497716 - 21497661
Alignment:
| Q |
26 |
cgaaccttgcatatattatgcatt-ttctttctcaactgagttaagatcacgatgac |
81 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||| |||||||| |||||||||| |
|
|
| T |
21497716 |
cgaaccttgcatatattatgcattgttcttac-caaccgagttaagctcacgatgac |
21497661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 70
Target Start/End: Original strand, 26133532 - 26133576
Alignment:
| Q |
26 |
cgaaccttgcatatattatgcattttctttctcaactgagttaag |
70 |
Q |
| |
|
|||||||||||||||||||||||| || || ||||||||||||| |
|
|
| T |
26133532 |
cgaaccttgcatatattatgcattgtccttaccaactgagttaag |
26133576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 13)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 81
Target Start/End: Complemental strand, 3650590 - 3650514
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgac |
81 |
Q |
| |
|
||||||| |||||| | | |||||||||| ||||||||||||||||| | | ||||||||||||| |||||||||| |
|
|
| T |
3650590 |
tggtggccggggtttgaaccccgaaccttacatatattatgcattttttctaccaactgagttaagctcacgatgac |
3650514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 24 - 70
Target Start/End: Complemental strand, 7679953 - 7679907
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaag |
70 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
7679953 |
cccgaaccttgcatatattatgcattgtctttgccaactgagttaag |
7679907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 77
Target Start/End: Original strand, 1877677 - 1877725
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
||||||||||||||||||||| ||| | |||||||||||||| |||||| |
|
|
| T |
1877677 |
accttgcatatattatgcattgtctatatcaactgagttaagctcacga |
1877725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 20469302 - 20469346
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
20469302 |
tggtggctggggttcgaactccgaaccttgcatatattatgcatt |
20469346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 77
Target Start/End: Complemental strand, 28084331 - 28084280
Alignment:
| Q |
26 |
cgaaccttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
||||||||||||||||||| |||| ||| | |||||||||||||| |||||| |
|
|
| T |
28084331 |
cgaaccttgcatatattattcattgtctctatcaactgagttaagctcacga |
28084280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 83
Target Start/End: Original strand, 12249496 - 12249554
Alignment:
| Q |
25 |
ccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgacaa |
83 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| ||| ||||||||| |||||| ||||| |
|
|
| T |
12249496 |
ccgaaccttgcatatattatacattatctttaccaattgagttaagctcacgaagacaa |
12249554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 22847471 - 22847524
Alignment:
| Q |
28 |
aaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgac |
81 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||| |||| |||||||||| |
|
|
| T |
22847471 |
aaccttgcatatattacgcattttccttaccaactgagctaagctcacgatgac |
22847524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 77
Target Start/End: Original strand, 17062354 - 17062402
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
||||||||||||||||| ||| ||| | |||||||||||||| |||||| |
|
|
| T |
17062354 |
accttgcatatattatgtattgtctatatcaactgagttaagctcacga |
17062402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 77
Target Start/End: Complemental strand, 17586004 - 17585956
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
||||||||||||||||| ||| ||| | |||||||||||||| |||||| |
|
|
| T |
17586004 |
accttgcatatattatgtattgtctatatcaactgagttaagctcacga |
17585956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 20275180 - 20275224
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
|||||||||||||| | | |||||||||||||| ||||||||||| |
|
|
| T |
20275180 |
tggtggctggggtttgaaccccgaaccttgcatgtattatgcatt |
20275224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 21061807 - 21061851
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
|||||||||||||| | | |||||||||||||| ||||||||||| |
|
|
| T |
21061807 |
tggtggctggggtttgaaccccgaaccttgcatgtattatgcatt |
21061851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 28440005 - 28439953
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacgatgac |
81 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||||||| |||| |||||||||| |
|
|
| T |
28440005 |
accttacatatattatgcattatctttatcaactgaattaaactcacgatgac |
28439953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 49
Target Start/End: Complemental strand, 32192956 - 32192920
Alignment:
| Q |
13 |
ggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||| |
|
|
| T |
32192956 |
ggggttcgaaccccgaaccttgcatatattatgcatt |
32192920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 10)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 5 - 81
Target Start/End: Complemental strand, 52119446 - 52119370
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgac |
81 |
Q |
| |
|
||||||| |||||||| | |||||||||||||||||||||||||| || || |||||||| |||| ||| |||||| |
|
|
| T |
52119446 |
tggtggccggggttcgaaccccgaaccttgcatatattatgcattgtccttaccaactgagctaagctcaagatgac |
52119370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 82
Target Start/End: Complemental strand, 11574299 - 11574246
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
|||||| |||||||||||||| || || |||||||||||||| ||||||||||| |
|
|
| T |
11574299 |
accttgtatatattatgcattatccttatcaactgagttaagctcacgatgaca |
11574246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 82
Target Start/End: Original strand, 47377361 - 47377417
Alignment:
| Q |
26 |
cgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
||||||||| |||||||||||||| || || ||||||||||||| ||||||||||| |
|
|
| T |
47377361 |
cgaaccttgtatatattatgcattgtccttaccaactgagttaagctcacgatgaca |
47377417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 77
Target Start/End: Complemental strand, 2078287 - 2078238
Alignment:
| Q |
28 |
aaccttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
|||||||||||||||||||||| ||| | ||||||||||||| |||||| |
|
|
| T |
2078287 |
aaccttgcatatattatgcattgtctctaccaactgagttaagttcacga |
2078238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 82
Target Start/End: Original strand, 4216414 - 4216467
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
||||||||||||||||||||| || || ||||||||| |||| |||||| |||| |
|
|
| T |
4216414 |
accttgcatatattatgcattgtccttatcaactgagctaagttcacgaggaca |
4216467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 17507690 - 17507734
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
||||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
17507690 |
tggtggcccgggttcgaatcccgaaccttgcatatattatgcatt |
17507734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 29631256 - 29631212
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
||||||| |||||| | | |||||||||||||||||||||||||| |
|
|
| T |
29631256 |
tggtggccggggtttgaatcccgaaccttgcatatattatgcatt |
29631212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Complemental strand, 39779094 - 39779050
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
|||||| ||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
39779094 |
tggtggttggggtttgaaccccgaaccttgcatatattatgcatt |
39779050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 76
Target Start/End: Complemental strand, 47039478 - 47039426
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
||||||| |||||||||||||||||| || || ||| |||||||||| ||||| |
|
|
| T |
47039478 |
cccgaactttgcatatattatgcattgtccttatcatctgagttaagctcacg |
47039426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 76
Target Start/End: Original strand, 47099045 - 47099097
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
|||||||||||||||||||||||||| | || ||||||||| |||| ||||| |
|
|
| T |
47099045 |
cccgaaccttgcatatattatgcattattcttatcaactgagctaagctcacg |
47099097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 22)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 5 - 83
Target Start/End: Complemental strand, 18789106 - 18789028
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgacaa |
83 |
Q |
| |
|
|||||||||||||| | | |||||||||||||||| ||||||||| ||| | |||||||| ||| ||||||| ||||| |
|
|
| T |
18789106 |
tggtggctggggtttgaaccccgaaccttgcatattttatgcattgtctctaccaactgagctaatatcacgaggacaa |
18789028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 31159503 - 31159434
Alignment:
| Q |
1 |
tttttggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaag |
70 |
Q |
| |
|
||||||||| | |||||||| | || ||| ||||||||||||||| ||| ||||| |||||||||||||| |
|
|
| T |
31159503 |
tttttggtgtccggggttcgaaccctgaatcttgcatatattatgtattgtctttatcaactgagttaag |
31159434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 69
Target Start/End: Complemental strand, 34206278 - 34206233
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaa |
69 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
34206278 |
cccgaaccttgcatatattatgcattgtctttaccaactgagttaa |
34206233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 77
Target Start/End: Original strand, 8545004 - 8545052
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
||||||||||||||||||||| || || |||||||||||||| |||||| |
|
|
| T |
8545004 |
accttgcatatattatgcattgtccttatcaactgagttaagctcacga |
8545052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 84
Target Start/End: Original strand, 25603990 - 25604070
Alignment:
| Q |
4 |
ttggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgacaac |
84 |
Q |
| |
|
|||||||| ||| |||| | |||||||||||||||||||||||| | || | ||||||||| |||| ||||| ||||||| |
|
|
| T |
25603990 |
ttggtggccgggattcgaaccccgaaccttgcatatattatgcactgtccatatcaactgagctaagctcacggtgacaac |
25604070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 76
Target Start/End: Complemental strand, 27679549 - 27679497
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||||| |||| ||||| |
|
|
| T |
27679549 |
cccgaaccttgcatatattatgcattatctttaccaactgagctaagctcacg |
27679497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 83
Target Start/End: Complemental strand, 31198752 - 31198701
Alignment:
| Q |
32 |
ttgcatatattatgcattttctttctcaactgagttaagatcacgatgacaa |
83 |
Q |
| |
|
|||||||||||||||||| || || |||||||||||||||||||| ||||| |
|
|
| T |
31198752 |
ttgcatatattatgcattatccttaccaactgagttaagatcacgaggacaa |
31198701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 30893979 - 30893925
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacgatgacaa |
83 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||| |||||| ||||| |
|
|
| T |
30893979 |
accttgcatatattatgcattgtctttacaaactgagttaagctcacgaggacaa |
30893925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 81
Target Start/End: Complemental strand, 31545919 - 31545865
Alignment:
| Q |
27 |
gaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgac |
81 |
Q |
| |
|
||||||||||||||||||||||| || | ||||||||||||| |||||||||| |
|
|
| T |
31545919 |
gaaccttgcatatattatgcattatcctaaccaactgagttaagctcacgatgac |
31545865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 82
Target Start/End: Complemental strand, 6624846 - 6624769
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
||||||| |||||||| | |||| ||||||||||||||||||||| || | |||||||| |||| |||||| |||| |
|
|
| T |
6624846 |
tggtggccggggttcgaaccccggaccttgcatatattatgcattgtccatgccaactgagctaagctcacgaggaca |
6624769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 82
Target Start/End: Original strand, 11637571 - 11637640
Alignment:
| Q |
13 |
ggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
|||||||| | |||||||||||||||| ||||||||| || | ||||||||||||| |||||| |||| |
|
|
| T |
11637571 |
ggggttcgaaccccgaaccttgcatattttatgcattgtccataccaactgagttaagctcacgaggaca |
11637640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 77
Target Start/End: Original strand, 12285616 - 12285665
Alignment:
| Q |
28 |
aaccttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
||||||||||||||||| ||| ||||| |||||||||||||| |||||| |
|
|
| T |
12285616 |
aaccttgcatatattatatattgtctttatcaactgagttaagttcacga |
12285665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 77
Target Start/End: Complemental strand, 18872718 - 18872665
Alignment:
| Q |
24 |
cccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||| ||||||||| |||||| |
|
|
| T |
18872718 |
cccgaaccttgcatatattatgcattttccataacaagtgagttaagctcacga |
18872665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 77
Target Start/End: Original strand, 23118065 - 23118114
Alignment:
| Q |
28 |
aaccttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
|||||| ||||||||||||||| || || |||||||||||||| |||||| |
|
|
| T |
23118065 |
aaccttacatatattatgcattgtccttatcaactgagttaagctcacga |
23118114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 82
Target Start/End: Complemental strand, 33654794 - 33654741
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
||||||||||||||||||||| || | ||||||||||||| ||||||||||| |
|
|
| T |
33654794 |
accttgcatatattatgcattgtccctaccaactgagttaagctcacgatgaca |
33654741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 82
Target Start/End: Complemental strand, 40446029 - 40445976
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
||||||||||||||||||||| || || ||||||||||||| |||||| |||| |
|
|
| T |
40446029 |
accttgcatatattatgcattgtccttatcaactgagttaaactcacgaggaca |
40445976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 5974240 - 5974292
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacgatgac |
81 |
Q |
| |
|
||||||||||||||||||||| || | || ||||||||||| |||||||||| |
|
|
| T |
5974240 |
accttgcatatattatgcattatccctatcgactgagttaagttcacgatgac |
5974292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 76
Target Start/End: Complemental strand, 11647244 - 11647196
Alignment:
| Q |
28 |
aaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
|||||||||||||||||||||| || || ||||||||||||| ||||| |
|
|
| T |
11647244 |
aaccttgcatatattatgcattgtccttaccaactgagttaagttcacg |
11647196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 49
Target Start/End: Original strand, 16752493 - 16752537
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
||||||||||| |||| | |||||| ||||||||||||||||||| |
|
|
| T |
16752493 |
tggtggctgggattcgaaccccgaatcttgcatatattatgcatt |
16752537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 77
Target Start/End: Complemental strand, 17230436 - 17230384
Alignment:
| Q |
25 |
ccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
||||| ||| ||||||||||||||| ||| | ||||||||| ||||||||||| |
|
|
| T |
17230436 |
ccgaatcttacatatattatgcattgtctctgtcaactgagctaagatcacga |
17230384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 77
Target Start/End: Original strand, 36623189 - 36623237
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacga |
77 |
Q |
| |
|
||||||||||||||||||||| | || |||||||||||||| |||||| |
|
|
| T |
36623189 |
accttgcatatattatgcattattcttatcaactgagttaagctcacga |
36623237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 41650954 - 41651006
Alignment:
| Q |
29 |
accttgcatatattatgcattttctttctcaactgagttaagatcacgatgac |
81 |
Q |
| |
|
||||||||||||||||||||| || | ||||||||||||| |||||||||| |
|
|
| T |
41650954 |
accttgcatatattatgcattgtccataccaactgagttaagctcacgatgac |
41651006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 76
Target Start/End: Complemental strand, 25459 - 25388
Alignment:
| Q |
5 |
tggtggctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacg |
76 |
Q |
| |
|
||||| |||||||||| | || | ||||||||||||||||||||| || || ||||||||||||| ||||| |
|
|
| T |
25459 |
tggtgtctggggttcgaaccctggaccttgcatatattatgcattgtccttaccaactgagttaagctcacg |
25388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 70
Target Start/End: Original strand, 42929 - 42988
Alignment:
| Q |
11 |
ctggggttcgcagcccgaaccttgcatatattatgcattttctttctcaactgagttaag |
70 |
Q |
| |
|
||||| |||| | |||||||||||||||||||||||||| | || |||||||||||||| |
|
|
| T |
42929 |
ctgggattcgaatcccgaaccttgcatatattatgcattattcttatcaactgagttaag |
42988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 82
Target Start/End: Complemental strand, 42268 - 42211
Alignment:
| Q |
25 |
ccgaaccttgcatatattatgcattttctttctcaactgagttaagatcacgatgaca |
82 |
Q |
| |
|
|||||||||||||||||||| |||| ||| | |||||| | ||||| ||||||||||| |
|
|
| T |
42268 |
ccgaaccttgcatatattatacattatctctatcaactaaattaagttcacgatgaca |
42211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 64292 - 64244
Alignment:
| Q |
1 |
tttttggtggctggggttcgcagcccgaaccttgcatatattatgcatt |
49 |
Q |
| |
|
|||||||||| |||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
64292 |
tttttggtggtcggggttcgaatcccggaccttgcatatattatgcatt |
64244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University