View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19838_low_17 (Length: 312)
Name: NF19838_low_17
Description: NF19838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19838_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 5e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 16 - 213
Target Start/End: Original strand, 36814963 - 36815162
Alignment:
| Q |
16 |
atgaacaatagtccaaaccaaaagcaaaaaagccataaaacaataggttaaaatatcagacccgtattatatggcagaatatgcaggaccagtagaacag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36814963 |
atgaacaatagtccaaaccaaaagcaaaaaagccataaaacaataggttaaaatatcagacccgtattatatggcagaatatgcaggaccagtagaacag |
36815062 |
T |
 |
| Q |
116 |
aatatgtat-atgcttattagtccctctga-annnnnnnatcaaaactcaaatttgatcgtagacttttcattatttacttgcaaccagagaattagtcc |
213 |
Q |
| |
|
||||||||| |||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36815063 |
aatatgtataatgcttattagtccctctgagatttttttatcaaaactcaaatttgatcgtagacttttcattatttacttgcaaccagagaattagtcc |
36815162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University