View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19838_low_22 (Length: 226)
Name: NF19838_low_22
Description: NF19838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19838_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 212
Target Start/End: Complemental strand, 12216911 - 12216718
Alignment:
| Q |
19 |
aggtagaatattctgattctcttatttttcacagtgatctagctagctgatgagttgttaccttgtgtgcctatatttcctcactgatcttgctgccaca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12216911 |
aggtagaatattctgattctcttatttttcacagtgatctagctagctgatgagttgttaccttgtgtgcctatatttcctcactgatcttactgccaca |
12216812 |
T |
|
| Q |
119 |
cgtgctttgccttgctcatattattgtagctgtcaaagttattttcgtcccacacatcatagattcatagcaaccagtttttgtcctatgcttc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12216811 |
cgtgctttgccttgctcatattattgtagctgtcaaagttattttcgtcccacacatcatagattcatagcaaccagtttttgtcctatgcttc |
12216718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University