View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19839_high_33 (Length: 313)
Name: NF19839_high_33
Description: NF19839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19839_high_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 140 - 287
Target Start/End: Original strand, 1663919 - 1664066
Alignment:
| Q |
140 |
tccctccacatacggtaccttacattgagaatgaaacgaatagcgaaaacaaagaaaaagtacagttgcaaagtattcaaaatacgtttataatttattt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1663919 |
tccctccacatacggtaccttacattgagaatgaaacgaatagcgaaaacaaagaaaaagtacagttgcaaagtattcaaaatacgtttataatttattt |
1664018 |
T |
|
| Q |
240 |
tgtgnnnnnnntaaataccctaactatgaattttatgggtgtgtcatt |
287 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
1664019 |
tgtgaaaaaaataaataccctaacttttaattttatgggtgtgtcatt |
1664066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 14 - 103
Target Start/End: Original strand, 1663746 - 1663835
Alignment:
| Q |
14 |
aaattttgtcattgaagcattttgtgaaaatgaagctttttcccctataaatcaggataagcaaattattcttttcatgaaatttagtta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1663746 |
aaattttgtcattgaagcattttgtgaaaatgaagctttttcccctataaatcaggataagcaaattattcttttcatgaaatttagtta |
1663835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University