View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19839_high_42 (Length: 251)
Name: NF19839_high_42
Description: NF19839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19839_high_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 49002994 - 49002770
Alignment:
| Q |
18 |
aattcaagaacatagcgaagatgtgtaggtgacaagaatggtgttgtagcttaaacattttcttttacnnnnnnnnnnnnn--aatgtttaaattctaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49002994 |
aattcaagaacatagcgaagatgtgtaggtgacaagaatggtgttgtagcttaaacattttcttttacctctctctctctctcaatgtttaaattctaaa |
49002895 |
T |
 |
| Q |
116 |
aaatttaaccaaaacaatttagtttgtttgccagtaacttagtccctttttaatcattgtaaaagactaaattattgccttctaattattgttatacaac |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49002894 |
aaattgaaccaaaacaatttagtttgtttgcctgtaacttagtccctttttaatcattgtaaaagactaaattattgccttttaattattgttatacaac |
49002795 |
T |
 |
| Q |
216 |
taattgtcttttttacgtggttcat |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
49002794 |
taattgtcttttttacgtggttcat |
49002770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University