View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19839_high_47 (Length: 236)
Name: NF19839_high_47
Description: NF19839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19839_high_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 220
Target Start/End: Original strand, 2612251 - 2612456
Alignment:
| Q |
15 |
cactgaaatgatatttagcttttcatcacctgaacccaaaacttcttagggttagaatccagacatatgtttggttaagaattcacatataaaaccaagc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2612251 |
cactgaaatgatatttagcttttcatcacctgaacccaaaacttcttagggttagaatccagacatatgtttggttaagaattcacatataaaaccaagc |
2612350 |
T |
|
| Q |
115 |
cctcctctagatgacattttctctgattaatactagaaccctaaatagaattcctgcaaatatgttcgatcttctcgaaaacggatgctggaatattgca |
214 |
Q |
| |
|
||| |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2612351 |
ccttctctagatgacattttctcttattagtactagaaccctaaatagaattcctgcaaatatgttcgatcttctcgaaaacggatgctggaatattgca |
2612450 |
T |
|
| Q |
215 |
agtttg |
220 |
Q |
| |
|
|||||| |
|
|
| T |
2612451 |
agtttg |
2612456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 122 - 220
Target Start/End: Original strand, 2612563 - 2612663
Alignment:
| Q |
122 |
tagatgacattttctctgattaatactagaaccctaaatagaattcctg--caaatatgttcgatcttctcgaaaacggatgctggaatattgcaagttt |
219 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| ||||| || | |||||||||||||||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
2612563 |
tagatgacattttctctgattagtagtagaaccccaaataattttttttttcaaatatgttcgatcttctcacaaacgaatgtcggaatattgcaagttt |
2612662 |
T |
|
| Q |
220 |
g |
220 |
Q |
| |
|
| |
|
|
| T |
2612663 |
g |
2612663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University