View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19839_low_31 (Length: 332)
Name: NF19839_low_31
Description: NF19839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19839_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 19 - 273
Target Start/End: Complemental strand, 343105 - 342855
Alignment:
| Q |
19 |
atcaccattgatgcaacaaaagttcctaattaatgatgaaatagtacttttcgtggatcaagttgaccactacaataacttgaaggaactgcagatattt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
343105 |
atcaccattgatgcaacaaaagttcctaat----gatgaaatagtacttttcgtggatcaagttgaccactacaataacttgaaggaactgcagatattt |
343010 |
T |
 |
| Q |
119 |
cttgtcttcctttccactcttcaccaggtttgagagtaattgctttttctacacaagcaggttggacacacaacatatgtttgtattcatcatctcccaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
343009 |
cttgtcttcctttccactcttcaccaggtttgagagtaattgctttttctacacaagcaggttggacacacaacatatgtttgtactcatcatctcccaa |
342910 |
T |
 |
| Q |
219 |
atcagatatgatctttgatttcttgtcccatgggttccatacaactacatacata |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
342909 |
atcagatatgatctttgatttcttgtcccatgggttccatacaactacatacata |
342855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University