View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19839_low_41 (Length: 257)
Name: NF19839_low_41
Description: NF19839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19839_low_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 21 - 246
Target Start/End: Original strand, 12559103 - 12559326
Alignment:
| Q |
21 |
ggccatggaccgtcgatgaagatcttgctctcatcaattacattgcaaatcatggtgaaggtcgatggaatactcttgctcgttcagctggtaattcaca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12559103 |
ggccatggaccgtcgatgaagatcttgctctcatcaattacattgcaaatcatggtgaaggtcgatggaatactcttgctcgttccgctggtaattcaca |
12559202 |
T |
|
| Q |
121 |
actcnnnnnnnnncttctactttttatggaagaataataagaac--tatatattatattatggaccactatagctgtttcatgattgcaattgttgatgg |
218 |
Q |
| |
|
||| ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12559203 |
act----ttttttcttctgctttttatggaagaataataagaactatatatattatattatggaccactatagctgtttcatgattgcaattgttgatgg |
12559298 |
T |
|
| Q |
219 |
gaaatcatatacttccactatattcttc |
246 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
12559299 |
gaaatcatatacttccactattttcttc |
12559326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University