View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1983_high_4 (Length: 486)
Name: NF1983_high_4
Description: NF1983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1983_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 2e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 92 - 277
Target Start/End: Complemental strand, 47905438 - 47905258
Alignment:
| Q |
92 |
cggtaagaagtgctaattaaagacggcgaaaagaattccagcaaaggaattacgattatccatgattaccaaataattggaggtgataaaggtgaacagg |
191 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47905438 |
cggtaagaaatgctaattaaagatggcgaaaagaattccagcaaaggaattacgattatccatgattaccaaataattggaggtgataaaggtgaacaag |
47905339 |
T |
 |
| Q |
192 |
ttattagagttaaaagtatgatgatcttatgttgtgctccttcacaagaacttactgtgaagtgaagcatctggtgtgtaaaaagc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47905338 |
ttattagagttaaaagtatgatgatcttatgttgtgctccttcacaagaacttactgt-----gaagcatctggtgtgtaaaaagc |
47905258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University