View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1983_low_14 (Length: 238)
Name: NF1983_low_14
Description: NF1983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1983_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 26615177 - 26615397
Alignment:
| Q |
1 |
tgtatgagctgagaaaattggaaaataaaatcagttataatgaattaatcatcttcgtgaaggggtaagatggcatgcatattatgatggtaaattttct |
100 |
Q |
| |
|
|||||||||||| ||||||||||| | ||||||||||| |||||||||||| || ||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
26615177 |
tgtatgagctgataaaattggaaa-tcaaatcagttatgatgaattaatcacctcagtgaaggggtaagatggcactcatattatgatgataaattttct |
26615275 |
T |
|
| Q |
101 |
ggaaacaagggattttcttcagggttttggtatcttccagcctgtaaaatagccacaatttttaacacaatattctttcaaatgcaataacaaaagaaac |
200 |
Q |
| |
|
| |||||||||||| ||||||||| ||||| ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26615276 |
gcaaacaagggattctcttcagggatttggcgtcttccagcctgtaaaataactacaatttttaacacaatattctttcaaatgcaataaaaaaagaaac |
26615375 |
T |
|
| Q |
201 |
tttatcaaaaaatagttgcaga |
222 |
Q |
| |
|
|| || |||||||||||||||| |
|
|
| T |
26615376 |
ttgataaaaaaatagttgcaga |
26615397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 87 - 192
Target Start/End: Original strand, 3215458 - 3215564
Alignment:
| Q |
87 |
atggtaaattttctggaaacaagggattttcttcagggttttggtatcttccagcctgtaaaatagccacaatttttaacac-aatattctttcaaatgc |
185 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||| | |||||||||||||||| ||| |||| | ||| |||| ||||||||||||||||| |
|
|
| T |
3215458 |
atggtaaattttctggaaagaagggattctcttcagggtttttgaatcttccagcctgtaatataatcacattattttacacaaatattctttcaaatgc |
3215557 |
T |
|
| Q |
186 |
aataaca |
192 |
Q |
| |
|
||||||| |
|
|
| T |
3215558 |
aataaca |
3215564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 91 - 192
Target Start/End: Original strand, 3224166 - 3224270
Alignment:
| Q |
91 |
taaattttctggaaacaagggattttcttcagggttttggtatcttccagcctgtaaaatagccacaatttttaacac---aatattctttcaaatgcaa |
187 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||| ||| ||| | ||| |||| |||||||||| |||||||| |
|
|
| T |
3224166 |
taaattttctggaaagaagggattctcttcagggtttttgtatcttccagcctgtaatataatcacgttattttacacacaaatattcttttaaatgcaa |
3224265 |
T |
|
| Q |
188 |
taaca |
192 |
Q |
| |
|
||||| |
|
|
| T |
3224266 |
taaca |
3224270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University