View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19840_high_2 (Length: 249)
Name: NF19840_high_2
Description: NF19840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19840_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 2 - 242
Target Start/End: Complemental strand, 11464360 - 11464120
Alignment:
| Q |
2 |
catcatcatccaaatatggtgagagatctccaatattgaaagttgcatgtactccatattctccgggcaaatcaatcttgtatgcattgtcattgatctt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11464360 |
catcatcatccaaatatggtgagagatctccaatattgaaagttgcatgtactccatattctccgggcaaatcaatcttgtatgcattgtcattgatctt |
11464261 |
T |
|
| Q |
102 |
tgatataactttggagggaccatcagctctaggcatgagcttattctttcttttgcttggggatctctcttttctcaaatggacccatacaagatcacct |
201 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11464260 |
tgatataactttgaagggaccatcagctctaggcatgagcttattctttcttttgcttgggaatctctcttttctcaaatggacccatacaagatcacct |
11464161 |
T |
|
| Q |
202 |
tcgttgaacaacttaggcttattactcttagacctttgctt |
242 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11464160 |
tcgttgaacaacttaggcttattattcttagacctttgctt |
11464120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University