View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19840_low_5 (Length: 231)
Name: NF19840_low_5
Description: NF19840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19840_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 17 - 195
Target Start/End: Original strand, 34938992 - 34939164
Alignment:
| Q |
17 |
atgaaattagtgaaagctaatgcaatattgttgttttttgggtgaaaatgatgcgagtgttagtgtacgtatcaacaatacataattttttcaaagagct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34938992 |
atgaaattagtgaaagctaatgcaatattgttgttttttgggtgaaaatgatgcgagtg------tacgtatcaacaatacataattttttcaaagagct |
34939085 |
T |
|
| Q |
117 |
gaattttcaaattagatagttggacttggactgctatttctgcacggaatatttgaatttattcattgcattgcatcga |
195 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
34939086 |
gaattttcaaattggatatttggacttggactgctatttctgcatggaatatttgaattcattcattgcattgcatcga |
34939164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University