View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19841_high_27 (Length: 317)
Name: NF19841_high_27
Description: NF19841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19841_high_27 |
 |  |
|
| [»] scaffold0062 (4 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0062 (Bit Score: 269; Significance: 1e-150; HSPs: 4)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 19 - 303
Target Start/End: Original strand, 5731 - 6015
Alignment:
| Q |
19 |
ttgtattgggaaaacaaggacaatattaatttggttgactacaagttatacaaccaaactaaaattgtacaaacatctgaagaatttgtgaaactttatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5731 |
ttgtattgggaaaacaaggacaatattaatttggttgactacaagttatacaaccaaactaaaattgtacaaacatctgaagaatttgtgaaactttatt |
5830 |
T |
 |
| Q |
119 |
caaagatagcgaatgactactctcctgaaaaattccttccaggaattagcaccgacccgggtgacaccgagcctgcagataagattattaagatgccaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5831 |
caaagatagcgaatgactactctcctgaaaaattccttccaggaattagcaccgacccgggtgacaccgagcctgcagataagattattaagatgccaag |
5930 |
T |
 |
| Q |
219 |
ggagatcttcattgctggctgcaaacatcttatgcaattctccacactccctggtatttttctatggaacgctcatgactctgtg |
303 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
5931 |
ggagatcttcattgctggatgcaaacatcttatgcaatactccacactccctggtatttttctttggaatgctcatgactctgtg |
6015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 208 - 300
Target Start/End: Original strand, 16242 - 16334
Alignment:
| Q |
208 |
aagatgccaagggagatcttcattgctggctgcaaacatcttatgcaattctccacactccctggtatttttctatggaacgctcatgactct |
300 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| | || | | ||||||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
16242 |
aagatgccaagggagcacttcattgctggctgcagacatctcctccagatagcatcactccctggtgtttttctttggaacgctgatgactct |
16334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 208 - 300
Target Start/End: Original strand, 26410 - 26502
Alignment:
| Q |
208 |
aagatgccaagggagatcttcattgctggctgcaaacatcttatgcaattctccacactccctggtatttttctatggaacgctcatgactct |
300 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| | || | | ||||||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
26410 |
aagatgccaagggagcacttcattgctggctgcagacatctcctccagatagcatcactccctggtgtttttctttggaacgctgatgactct |
26502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 208 - 300
Target Start/End: Original strand, 36576 - 36668
Alignment:
| Q |
208 |
aagatgccaagggagatcttcattgctggctgcaaacatcttatgcaattctccacactccctggtatttttctatggaacgctcatgactct |
300 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| | || | | ||||||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
36576 |
aagatgccaagggagcacttcattgctggctgcagacatctcctccagatagcatcactccctggtgtttttctttggaacgctgatgactct |
36668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University