View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19841_high_29 (Length: 307)
Name: NF19841_high_29
Description: NF19841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19841_high_29 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 90 - 307
Target Start/End: Complemental strand, 39323093 - 39322881
Alignment:
| Q |
90 |
aatcctgtagtcaattttaatgcttcgaatatgagcattttctttatcaataaggcctccaaagcgggctttgggctcaacatgaaagttgcagatctat |
189 |
Q |
| |
|
||||||| ||||| ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39323093 |
aatcctgcagtcagttttaatgcttcggatatgagcatttt-tttatcaataaggcctccaaagcgggctttgggctcaacatgaaagttgcatatctat |
39322995 |
T |
 |
| Q |
190 |
tacttagcttaccggcgcatatttgcacgcctcgttatccaaacgtcaaacaaagttatgacatgcacgatgaattggggtcaaaacacattaaatatgg |
289 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39322994 |
tacttagctttccgacgcatatttgcacgcctcgtttggataacgt----caaagttatgacatgcacgatgaataggggtcaaaacacattaaatatgg |
39322899 |
T |
 |
| Q |
290 |
aaattaatccaagaatta |
307 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
39322898 |
aaattaatccaagaatta |
39322881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 296
Target Start/End: Complemental strand, 28813957 - 28813816
Alignment:
| Q |
155 |
gggctttgggctcaacatgaaagttgcagatctattacttagcttaccggcgcatatttgcacgcctcgttatccaaacgtcaaacaaagttatgacatg |
254 |
Q |
| |
|
|||||| | ||||||||||||||||| |||| || |||||||| || ||| ||||| ||||||| || | |||| ||| |||||||||| | || |
|
|
| T |
28813957 |
gggcttcgcgctcaacatgaaagttgtagataatttccttagctttccaacgcttatttttacgcctcattctgataacggcaaccaaagttatggcctg |
28813858 |
T |
 |
| Q |
255 |
cacgatgaattggggtcaaaacacattaaatatggaaattaa |
296 |
Q |
| |
|
||| |||| |||||||||||||||||| ||||||||||| |
|
|
| T |
28813857 |
cacagtgaacaagggtcaaaacacattaaaaatggaaattaa |
28813816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University